From AureoWiki
Jump to navigation Jump to search

NCBI: 10-JUN-2013

Summary[edit | edit source]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL1095 [new locus tag: SACOL_RS05590 ]
  • pan locus tag?: SAUPAN003307000
  • symbol: cydB
  • pan gene symbol?: cydB
  • synonym:
  • product: cytochrome d ubiquinol oxidase subunit II

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SACOL1095 [new locus tag: SACOL_RS05590 ]
  • symbol: cydB
  • product: cytochrome d ubiquinol oxidase subunit II
  • replicon: chromosome
  • strand: +
  • coordinates: 1105798..1106817
  • length: 1020
  • essential: unknown other strains

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    ATGATTTATGCATTTATAGGTATAACAGTGTTATGGTTGTTTTTATTTTGCTATATCATT
    ATTGCTTCTATAGATTTTGGGGCAGGTTTCTTCGCATTGCATTCAAAGTTAACTGGTGAT
    GAAAAGAAAATTAATCACTTAATTTCACGTTATTTAAACCCAGTTTGGGAAGTTACGAAT
    GTATTCTTTGTTTTCTTCTTCGTAGGATTCGTAGGTTTCTTTCCAGAGTCAATCAAATAT
    TTAGGCACGGTATTGTTAATACCAGGTTCAATAGCACTGATTATGATATCGTTGAGAAAC
    AGTTTTTATGCATTTGAAAATTATGGTCAAGATACAAAATTAGCATGGATGATCATGTAT
    GGGGTAAGTGGATTATTAATTCCAGCTTCATTATCTACTGCTTTAACTATTACAGAAGGT
    GGCTATATTAATGTTCGAAACAATGTTATCGATCTAGATTGGGTGCAGTTATTATTAAGC
    CCATTTGCTTGGTCTGTAGTATTCTTGGCAATTATTTCAGTTTTATATATTTCATCAGGA
    TTTTTGACATATTATGCTAAAAAAGCAAATGACGAACCAGCATATAATTTAACAAGACAA
    TGGCACATATTTTTAGGGCCGCCGATGATTATCATTTGTTTATTCGTATTTCTATCATTA
    CGCATTCAAAATTCTGAACATTTTTATTCAGCTGTTTTTGACTATTGGTGGATGTTTGGT
    ATAAGTTTCTTATTCTTTGCATTAGCTTCATTGTTAACATTCTTTAAGAAAAAACATGGT
    TTGGCTTTTGTATTTGTTATTTTACAAATGATGTTCGCGTTCTTTGGCTATGGAATTAGT
    AAATTGCCATACCTTTTATATCCGTTTGTAAAAATTACAGATGCATATGTTAATCCAGAA
    ATGGGCTGGACATTAGTGATTGTCTTTATTTTAGGTTTACTTTTATTACTTCCATCGTTA
    ATATTATTATTAAGATTATTTGTTTTCGACAAAGAATATGTTGAAGGAAAGAAATCATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SACOL1095 [new locus tag: SACOL_RS05590 ]
  • symbol: CydB
  • description: cytochrome d ubiquinol oxidase subunit II
  • length: 339
  • theoretical pI: 8.52158
  • theoretical MW: 38946.1
  • GRAVY: 0.883481

Function[edit | edit source]

  • reaction:
    EC 1.10.3.-?  ExPASy
  • TIGRFAM:
  • TheSEED:  
    Respiration Electron accepting reactions Terminal cytochrome d ubiquinol oxidases  Cytochrome d ubiquinol oxidase subunit II (EC 1.10.3.-)
    and 3 more
    Terminal cytochrome oxidases  Cytochrome d ubiquinol oxidase subunit II (EC 1.10.3.-)
    Bacterial RNA-metabolizing Zn-dependent hydrolases  Cytochrome d ubiquinol oxidase subunit II (EC 1.10.3.-)
    Conserved gene cluster associated with Met-tRNA formyltransferase  Cytochrome d ubiquinol oxidase subunit II (EC 1.10.3.-)
  • PFAM:
    no clan defined Cyt_bd_oxida_II; Cytochrome bd terminal oxidase subunit II (PF02322; HMM-score: 137.2)
    and 2 more
    DUF2516; Protein of unknown function (DUF2516) (PF10724; HMM-score: 17.2)
    2heme_cytochrom (CL0328) Ni_hydr_CYTB; Prokaryotic cytochrome b561 (PF01292; HMM-score: 5.6)

Structure, modifications & interactions[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic Membrane
    • Cytoplasmic Score: 0
    • Cytoplasmic Membrane Score: 10
    • Cellwall Score: 0
    • Extracellular Score: 0
    • Internal Helices: 9
  • LocateP: Multi-transmembrane
    • Prediction by SwissProt Classification: Membrane
    • Pathway Prediction: Sec-(SPI)
    • Intracellular possibility: 0.17
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: -1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.020286
    • TAT(Tat/SPI): 0.000196
    • LIPO(Sec/SPII): 0.027353
  • predicted transmembrane helices (TMHMM): 9

Accession numbers[edit | edit source]

Protein sequence[edit | edit source]

  • MIYAFIGITVLWLFLFCYIIIASIDFGAGFFALHSKLTGDEKKINHLISRYLNPVWEVTNVFFVFFFVGFVGFFPESIKYLGTVLLIPGSIALIMISLRNSFYAFENYGQDTKLAWMIMYGVSGLLIPASLSTALTITEGGYINVRNNVIDLDWVQLLLSPFAWSVVFLAIISVLYISSGFLTYYAKKANDEPAYNLTRQWHIFLGPPMIIICLFVFLSLRIQNSEHFYSAVFDYWWMFGISFLFFALASLLTFFKKKHGLAFVFVILQMMFAFFGYGISKLPYLLYPFVKITDAYVNPEMGWTLVIVFILGLLLLLPSLILLLRLFVFDKEYVEGKKS

Experimental data[edit | edit source]

  • experimental localization: Integral membrane [1]

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

  1. Andreas Otto, Jan Maarten van Dijl, Michael Hecker, Dörte Becher
    The Staphylococcus aureus proteome.
    Int J Med Microbiol: 2014, 304(2);110-20
    [PubMed:24439828] [WorldCat.org] [DOI] (I p)

Relevant publications[edit | edit source]

Lalitha Voggu, Steffen Schlag, Raja Biswas, Ralf Rosenstein, Christian Rausch, Friedrich Götz
Microevolution of cytochrome bd oxidase in Staphylococci and its implication in resistance to respiratory toxins released by Pseudomonas.
J Bacteriol: 2006, 188(23);8079-86
[PubMed:17108291] [WorldCat.org] [DOI] (P p)