From AureoWiki
Jump to navigation Jump to search

NCBI: 10-JUN-2013

⊟Summary[edit | edit source]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL1509 [new locus tag: SACOL_RS07680 ]
  • pan locus tag?: SAUPAN003929000
  • symbol: ndk
  • pan gene symbol?: ndk
  • synonym:
  • product: nucleoside diphosphate kinase

⊟Additional information (user-provided)[edit | edit source]

⊟Genome View[edit | edit source]

⊟Gene[edit | edit source]

⊟General[edit | edit source]

  • type: CDS
  • locus tag: SACOL1509 [new locus tag: SACOL_RS07680 ]
  • symbol: ndk
  • product: nucleoside diphosphate kinase
  • replicon: chromosome
  • strand: -
  • coordinates: 1549036..1549485
  • length: 450
  • essential: unknown other strains

⊟Accession numbers[edit | edit source]

⊟Phenotype[edit | edit source]

⊟Additional information (user-provided)[edit | edit source]

⊟DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    GTGGAACGTACATTTTTAATGATTAAACCAGATGCAGTACAAAGAAATCTAATTGGTGAA
    GTAATTTCAAGAATTGAAAGAAAAGGACTAAAACTTGTCGGTGGTAAATTAATGCAAGTA
    CCAATGGAACTTGCTGAAACACATTATGGTGAACACCAAGGTAAACCATTTTATAATGAT
    TTAATTTCATTTATTACATCAGCACCAGTGTTCGCAATGGTAGTTGAAGGTGAAGATGCA
    GTTAATGTATCTAGACATATTATTGGCAGCACCAATCCTTCAGAAGCTTCACCAGGATCA
    ATTAGAGGTGATTTAGGTTTAACTGTTGGTAGAAATATCATTCACGGTTCAGATTCATTA
    GAGTCTGCTGAACGTGAAATTAATCTATGGTTTAATGAAAATGAAATTACTAGCTATGCT
    TCACCACGTGATGCATGGTTATATGAATAA
    60
    120
    180
    240
    300
    360
    420
    450


⊟Protein[edit | edit source]

Protein Data Bank: 3Q83
Protein Data Bank: 3Q86
Protein Data Bank: 3Q89
Protein Data Bank: 3Q8U
Protein Data Bank: 3Q8V
Protein Data Bank: 3Q8Y

⊟General[edit | edit source]

  • locus tag: SACOL1509 [new locus tag: SACOL_RS07680 ]
  • symbol: Ndk
  • description: nucleoside diphosphate kinase
  • length: 149
  • theoretical pI: 4.82307
  • theoretical MW: 16574.6
  • GRAVY: -0.248322

⊟Function[edit | edit source]

  • reaction:
    EC 2.7.4.6?  ExPASy
    Nucleoside-diphosphate kinase ATP + nucleoside diphosphate = ADP + nucleoside triphosphate
  • TIGRFAM:
  • TheSEED  :
    • Nucleoside diphosphate kinase (EC 2.7.4.6)
    Nucleosides and Nucleotides Purines Purine conversions  Nucleoside diphosphate kinase (EC 2.7.4.6)
    and 1 more
    Nucleosides and Nucleotides Pyrimidines pyrimidine conversions  Nucleoside diphosphate kinase (EC 2.7.4.6)
  • PFAM:
    no clan defined NDK; Nucleoside diphosphate kinase (PF00334; HMM-score: 196.8)

⊟Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors: Mg2+
  • effectors:

⊟Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • DeepLocPro: Cytoplasmic
    • Cytoplasmic Score: 0.9754
    • Cytoplasmic Membrane Score: 0.0045
    • Cell wall & surface Score: 0.0002
    • Extracellular Score: 0.0199
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 1
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.007039
    • TAT(Tat/SPI): 0.002696
    • LIPO(Sec/SPII): 0.000723
  • predicted transmembrane helices (TMHMM): 0

⊟Accession numbers[edit | edit source]

⊟Additional information (user-provided)[edit | edit source]

⊟Protein sequence[edit | edit source]

  • MERTFLMIKPDAVQRNLIGEVISRIERKGLKLVGGKLMQVPMELAETHYGEHQGKPFYNDLISFITSAPVFAMVVEGEDAVNVSRHIIGSTNPSEASPGSIRGDLGLTVGRNIIHGSDSLESAEREINLWFNENEITSYASPRDAWLYE

⊟Experimental data[edit | edit source]

  • experimentally validated: PeptideAtlas
  • protein localization: Cytoplasmic [1] [2] [3]
  • quantitative data / protein copy number per cell: 110 [4]
  • interaction partners:

⊟Expression & Regulation[edit | edit source]

⊟Operon[edit | edit source]

⊟Regulation[edit | edit source]

  • regulator:

⊟Additional information (user-provided)[edit | edit source]

⊟Transcription pattern[edit | edit source]

⊟Protein synthesis (provided by Aureolib)[edit | edit source]

⊟Protein stability[edit | edit source]

  • half-life: 98.7 h [5]

⊟Biological Material[edit | edit source]

⊟Mutants[edit | edit source]

⊟Expression vector[edit | edit source]

⊟lacZ fusion[edit | edit source]

⊟GFP fusion[edit | edit source]

⊟two-hybrid system[edit | edit source]

⊟FLAG-tag construct[edit | edit source]

⊟Antibody[edit | edit source]

⊟Additional information (user-provided)[edit | edit source]

⊟Other information (user-provided)[edit | edit source]

You can add further information about the gene and protein here. [edit]

⊟Literature[edit | edit source]

⊟References[edit | edit source]

  1. ↑ Dörte Becher, Kristina Hempel, Susanne Sievers, Daniela Zühlke, Jan Pané-Farré, Andreas Otto, Stephan Fuchs, Dirk Albrecht, Jörg Bernhardt, Susanne Engelmann, Uwe Völker, Jan Maarten van Dijl, Michael Hecker
    A proteomic view of an important human pathogen--towards the quantification of the entire Staphylococcus aureus proteome.
    PLoS One: 2009, 4(12);e8176
    [PubMed:19997597] [WorldCat.org] [DOI] (I e)
  2. ↑ Kristina Hempel, Florian-Alexander Herbst, Martin Moche, Michael Hecker, Dörte Becher
    Quantitative proteomic view on secreted, cell surface-associated, and cytoplasmic proteins of the methicillin-resistant human pathogen Staphylococcus aureus under iron-limited conditions.
    J Proteome Res: 2011, 10(4);1657-66
    [PubMed:21323324] [WorldCat.org] [DOI] (I p)
  3. ↑ Andreas Otto, Jan Maarten van Dijl, Michael Hecker, Dörte Becher
    The Staphylococcus aureus proteome.
    Int J Med Microbiol: 2014, 304(2);110-20
    [PubMed:24439828] [WorldCat.org] [DOI] (I p)
  4. ↑ Daniela Zühlke, Kirsten Dörries, Jörg Bernhardt, Sandra Maaß, Jan Muntel, Volkmar Liebscher, Jan Pané-Farré, Katharina Riedel, Michael Lalk, Uwe Völker, Susanne Engelmann, Dörte Becher, Stephan Fuchs, Michael Hecker
    Costs of life - Dynamics of the protein inventory of Staphylococcus aureus during anaerobiosis.
    Sci Rep: 2016, 6;28172
    [PubMed:27344979] [WorldCat.org] [DOI] (I e)
  5. ↑ Stephan Michalik, Jörg Bernhardt, Andreas Otto, Martin Moche, Dörte Becher, Hanna Meyer, Michael Lalk, Claudia Schurmann, Rabea Schlüter, Holger Kock, Ulf Gerth, Michael Hecker
    Life and death of proteins: a case study of glucose-starved Staphylococcus aureus.
    Mol Cell Proteomics: 2012, 11(9);558-70
    [PubMed:22556279] [WorldCat.org] [DOI] (I p)

⊟Relevant publications[edit | edit source]

Sandeep Kumar Srivastava, Kalagiri Rajasree, B Gopal
Conformational basis for substrate recognition and regulation of catalytic activity in Staphylococcus aureus nucleoside di-phosphate kinase.
Biochim Biophys Acta: 2011, 1814(10);1349-57
[PubMed:21745603] [WorldCat.org] [DOI] (P p)