From AureoWiki
Jump to navigation Jump to search

NCBI: 06-JUL-2013

Summary[edit | edit source]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_1378 [new locus tag: NWMN_RS07760 ]
  • pan locus tag?: SAUPAN003929000
  • symbol: ndk
  • pan gene symbol?: ndk
  • synonym:
  • product: nucleoside diphosphate kinase

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: NWMN_1378 [new locus tag: NWMN_RS07760 ]
  • symbol: ndk
  • product: nucleoside diphosphate kinase
  • replicon: chromosome
  • strand: -
  • coordinates: 1545215..1545664
  • length: 450
  • essential: unknown other strains

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    GTGGAACGTACATTTTTAATGATTAAACCAGATGCAGTACAAAGAAATCTAATTGGTGAA
    GTAATTTCAAGAATTGAAAGAAAAGGACTAAAACTTGTCGGTGGTAAATTAATGCAAGTA
    CCAATGGAACTTGCTGAAACACATTATGGTGAACACCAAGGTAAACCATTTTATAATGAT
    TTAATTTCATTTATTACATCAGCACCAGTGTTCGCAATGGTAGTTGAAGGTGAAGATGCA
    GTTAATGTATCTAGACATATTATTGGCAGCACCAATCCTTCAGAAGCTTCACCAGGATCA
    ATTAGAGGTGATTTAGGTTTAACTGTTGGTAGAAATATCATTCACGGTTCAGATTCATTA
    GAGTCTGCTGAACGTGAAATTAATCTATGGTTTAATGAAAATGAAATTACTAGCTATGCT
    TCACCACGTGATGCATGGTTATATGAATAA
    60
    120
    180
    240
    300
    360
    420
    450

Protein[edit | edit source]

Protein Data Bank: 3Q83
Protein Data Bank: 3Q86
Protein Data Bank: 3Q89
Protein Data Bank: 3Q8U
Protein Data Bank: 3Q8V
Protein Data Bank: 3Q8Y

General[edit | edit source]

  • locus tag: NWMN_1378 [new locus tag: NWMN_RS07760 ]
  • symbol: Ndk
  • description: nucleoside diphosphate kinase
  • length: 149
  • theoretical pI: 4.82307
  • theoretical MW: 16574.6
  • GRAVY: -0.248322

Function[edit | edit source]

  • reaction:
    EC 2.7.4.6?  ExPASy
    Nucleoside-diphosphate kinase ATP + nucleoside diphosphate = ADP + nucleoside triphosphate
  • TIGRFAM:
  • TheSEED:  
    Nucleosides and Nucleotides Purines Purine conversions  Nucleoside diphosphate kinase (EC 2.7.4.6)
    and 1 more
    Pyrimidines pyrimidine conversions  Nucleoside diphosphate kinase (EC 2.7.4.6)
  • PFAM:
    no clan defined NDK; Nucleoside diphosphate kinase (PF00334; HMM-score: 192.2)
    and 1 more
    TIM_barrel (CL0036) OMPdecase; Orotidine 5'-phosphate decarboxylase / HUMPS family (PF00215; HMM-score: 11.7)

Structure, modifications & interactions[edit | edit source]

  • domains:
  • modifications:
  • cofactors: Mg2+
  • effectors:
  • protein partners:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 1
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.007039
    • TAT(Tat/SPI): 0.002696
    • LIPO(Sec/SPII): 0.000723
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

Protein sequence[edit | edit source]

  • MERTFLMIKPDAVQRNLIGEVISRIERKGLKLVGGKLMQVPMELAETHYGEHQGKPFYNDLISFITSAPVFAMVVEGEDAVNVSRHIIGSTNPSEASPGSIRGDLGLTVGRNIIHGSDSLESAEREINLWFNENEITSYASPRDAWLYE

Experimental data[edit | edit source]

  • experimentally validated: no data available

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

Relevant publications[edit | edit source]