Jump to navigation
Jump to search
NCBI: 10-JUN-2013
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus COL
- locus tag: SACOL2658 [new locus tag: SACOL_RS13925 ]
- pan locus tag?: SAUPAN006366000
- symbol: SACOL2658
- pan gene symbol?: argR1
- synonym:
- product: ArgR family transcriptional regulator
⊟Additional information (user-provided)[edit | edit source]
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: SACOL2658 [new locus tag: SACOL_RS13925 ]
- symbol: SACOL2658
- product: ArgR family transcriptional regulator
- replicon: chromosome
- strand: -
- coordinates: 2720034..2720483
- length: 450
- essential: unknown other strains
⊟Accession numbers[edit | edit source]
- Gene ID: 3237033 NCBI
- RefSeq: YP_187446 NCBI
- BioCyc: see SACOL_RS13925
- MicrobesOnline: 914125 MicrobesOnline
⊟Phenotype[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301
361
421ATGAAGAAAAGTAAACGATTAGAAATTGTTTCTACAATAGTTAAAAAGCATAAGATTTAT
AAAAAAGAACAAATCATTTCATATATTGAAGAATATTTTGGTGTAAGATATAGTGCAACA
ACAATTGCTAAAGACTTGAAGGAACTAAATATATATCGTGTCCCTATCGATTGTGAGACA
TGGATTTATAAAGCTATTAATAATCAAACAGAACAAGAGATGAGAGAAAAGTTTAGACAC
TATTGTGAACATGAAGTTCTAAGTTCAATCATCAATGGTTCATACATTATCGTCAAAACC
TCACCTGGTTTCGCCCAAGGCATAAACTATTTTATCGATCAGCTAAATATAGAAGAGATA
TTAGGTACGGTGAGTGGAAATGACACTACATTAATCTTAACTGCCTCAAATGATATGGCA
GAATACGTATATGCAAAATTATTTAAATAG60
120
180
240
300
360
420
450
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: SACOL2658 [new locus tag: SACOL_RS13925 ]
- symbol: SACOL2658
- description: ArgR family transcriptional regulator
- length: 149
- theoretical pI: 8.1664
- theoretical MW: 17376.9
- GRAVY: -0.290604
⊟Function[edit | edit source]
- TIGRFAM: Amino acid biosynthesis Glutamate family arginine repressor (TIGR01529; HMM-score: 84.3)Regulatory functions DNA interactions arginine repressor (TIGR01529; HMM-score: 84.3)
- TheSEED :
- Arginine pathway regulatory protein ArgR, repressor of arg regulon
Amino Acids and Derivatives Arginine; urea cycle, polyamines Arginine and Ornithine Degradation Arginine pathway regulatory protein ArgR, repressor of arg regulonand 2 more - PFAM: Arg_repressor_C (CL0738) Arg_repressor_C; Arginine repressor, C-terminal domain (PF02863; HMM-score: 64.8)and 5 moreHTH (CL0123) Arg_repressor; Arginine repressor, DNA binding domain (PF01316; HMM-score: 32.8)HTH_33; Winged helix-turn helix (PF13592; HMM-score: 13.7)Saposin_like (CL0707) SapB_1; Saposin-like type B, region 1 (PF05184; HMM-score: 13.5)PIN (CL0280) XPG_N; XPG N-terminal domain (PF00752; HMM-score: 12.9)E-set (CL0159) DUF5065; Domain of unknown function (DUF5065) (PF16723; HMM-score: 12.8)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic
- Cytoplasmic Score: 9.97
- Cytoplasmic Membrane Score: 0
- Cellwall Score: 0.01
- Extracellular Score: 0.02
- Internal Helices: 0
- DeepLocPro: Cytoplasmic
- Cytoplasmic Score: 0.8537
- Cytoplasmic Membrane Score: 0.0219
- Cell wall & surface Score: 0.0005
- Extracellular Score: 0.1239
- LocateP: Intracellular
- Prediction by SwissProt Classification: Cytoplasmic
- Pathway Prediction: No pathway
- Intracellular possibility: 1
- Signal peptide possibility: -1
- N-terminally Anchored Score: 1
- Predicted Cleavage Site: No CleavageSite
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.010657
- TAT(Tat/SPI): 0.000502
- LIPO(Sec/SPII): 0.001593
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Protein sequence[edit | edit source]
- MKKSKRLEIVSTIVKKHKIYKKEQIISYIEEYFGVRYSATTIAKDLKELNIYRVPIDCETWIYKAINNQTEQEMREKFRHYCEHEVLSSIINGSYIIVKTSPGFAQGINYFIDQLNIEEILGTVSGNDTTLILTASNDMAEYVYAKLFK
⊟Experimental data[edit | edit source]
- experimentally validated: data available for NCTC8325
- protein localization: Cytoplasmic [1]
- quantitative data / protein copy number per cell:
- interaction partners:
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
- MicrobesOnline: no polycistronic organisation predicted
⊟Regulation[edit | edit source]
- regulator:
⊟Additional information (user-provided)[edit | edit source]
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
- Aureolib: no data available
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Other information (user-provided)[edit | edit source]
You can add further information about the gene and protein here. [edit]
⊟Literature[edit | edit source]
⊟References[edit | edit source]
- ↑ Andreas Otto, Jan Maarten van Dijl, Michael Hecker, Dörte Becher
The Staphylococcus aureus proteome.
Int J Med Microbiol: 2014, 304(2);110-20
[PubMed:24439828] [WorldCat.org] [DOI] (I p)