Jump to navigation
Jump to search
NCBI: 02-MAR-2017
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus COL
- locus tag: SACOL_RS01735 [old locus tag: SACOL0345 ]
- pan locus tag?: SAUPAN001448000
- symbol: SACOL_RS01735
- pan gene symbol?: —
- synonym:
- product: hypothetical protein
⊟Additional information (user-provided)[edit | edit source]
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: SACOL_RS01735 [old locus tag: SACOL0345 ]
- symbol: SACOL_RS01735
- product: hypothetical protein
- replicon: chromosome
- strand: +
- coordinates: 367360..367581
- length: 222
- essential: unknown other strains
⊟Accession numbers[edit | edit source]
- Location: NC_002951 (367360..367581) NCBI
- BioCyc: SACOL_RS01735 BioCyc
- MicrobesOnline: see SACOL0345
⊟Phenotype[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟DNA sequence[edit | edit source]
- 1
61
121
181ATGCCGAAAGAAAAATATTACTTATACCGAGAAGATGGCACGGAAGATATCAAAGTCATC
AAGTATAAAGACAACGTAAATGAAGTTTATTCGCTCACAGGAGCCCATTTCAGCGACGAA
AAGAAAATTATGACTGATAGTGACCTAAAACGATTTAAAGGCGCTCACGGGCTTTTATAT
GAGCAAGAGCTAGGATTACAAGCAACGATATTTGATATTTAG60
120
180
222
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: SACOL_RS01735 [old locus tag: SACOL0345 ]
- symbol: SACOL_RS01735
- description: hypothetical protein
- length: 73
- theoretical pI: 5.10222
- theoretical MW: 8551.62
- GRAVY: -0.69589
⊟Function[edit | edit source]
- TIGRFAM: hemerythrin family non-heme iron protein (TIGR00058; HMM-score: 14)DNA metabolism DNA replication, recombination, and repair DNA mismatch repair endonuclease MutH (TIGR02248; HMM-score: 11.7)
- TheSEED: see SACOL0345
- PFAM: no clan defined DUF3269; Protein of unknown function (DUF3269) (PF11673; HMM-score: 180.2)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic
- Cytoplasmic Score: 7.5
- Cytoplasmic Membrane Score: 1.15
- Cellwall Score: 0.62
- Extracellular Score: 0.73
- Internal Helices: 0
- DeepLocPro: Cytoplasmic
- Cytoplasmic Score: 0.7283
- Cytoplasmic Membrane Score: 0.0233
- Cell wall & surface Score: 0.0003
- Extracellular Score: 0.2481
- LocateP:
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.004156
- TAT(Tat/SPI): 0.000367
- LIPO(Sec/SPII): 0.000598
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Protein sequence[edit | edit source]
- MPKEKYYLYREDGTEDIKVIKYKDNVNEVYSLTGAHFSDEKKIMTDSDLKRFKGAHGLLYEQELGLQATIFDI
⊟Experimental data[edit | edit source]
- experimentally validated: data available for NCTC8325
- protein localization:
- quantitative data / protein copy number per cell:
- interaction partners:
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
⊟Regulation[edit | edit source]
- regulator:
⊟Additional information (user-provided)[edit | edit source]
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: no data available
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
- Aureolib: no data available
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Other information (user-provided)[edit | edit source]
You can add further information about the gene and protein here. [edit]
⊟Literature[edit | edit source]
⊟References[edit | edit source]