Jump to navigation
Jump to search
NCBI: 02-MAR-2017
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus COL
- locus tag: SACOL_RS03590 [old locus tag: SACOL0698 ]
- pan locus tag?: SAUPAN002518000
- symbol: SACOL_RS03590
- pan gene symbol?: tagD
- synonym:
- product: glycerol-3-phosphate cytidylyltransferase
⊟Additional information (user-provided)[edit | edit source]
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: SACOL_RS03590 [old locus tag: SACOL0698 ]
- symbol: SACOL_RS03590
- product: glycerol-3-phosphate cytidylyltransferase
- replicon: chromosome
- strand: +
- coordinates: 722415..722813
- length: 399
- essential: unknown other strains
⊟Accession numbers[edit | edit source]
- Location: NC_002951 (722415..722813) NCBI
- BioCyc: SACOL_RS03590 BioCyc
- MicrobesOnline: see SACOL0698
⊟Phenotype[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301
361ATGAAACGTGTAATAACATATGGCACATATGACTTACTTCACTATGGTCATATCGAATTG
CTTCGTCGTGCAAGAGAGATGGGCGATTATTTAATAGTAGCATTATCAACAGATGAATTT
AATCAAATTAAACATAAAAAATCTTATTATGATTATGAACAACGAAAAATGATGCTTGAA
TCAATACGCTATGTCGATTTAGTCATTCCAGAAAAGGGCTGGGGACAAAAAGAAGACGAT
GTCGAAAAATTTGATGTAGATGTTTTTGTTATGGGACATGACTGGGAAGGTGAATTCGAC
TTCTTAAAGGATAAATGTGAAGTCATTTATTTAAAACGTACAGAAGGCATTTCGACGACT
AAAATCAAACAAGAATTATATGGTAAAGATGCTAAATAA60
120
180
240
300
360
399
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: SACOL_RS03590 [old locus tag: SACOL0698 ]
- symbol: SACOL_RS03590
- description: glycerol-3-phosphate cytidylyltransferase
- length: 132
- theoretical pI: 5.69067
- theoretical MW: 15817
- GRAVY: -0.660606
⊟Function[edit | edit source]
- reaction: EC 2.7.7.15? ExPASyCholine-phosphate cytidylyltransferase CTP + phosphocholine = diphosphate + CDP-choline
- TIGRFAM: Cell envelope Biosynthesis and degradation of murein sacculus and peptidoglycan glycerol-3-phosphate cytidylyltransferase (TIGR01518; EC 2.7.7.39; HMM-score: 201)and 5 morecytidyltransferase-like domain (TIGR00125; HMM-score: 77.8)Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides bifunctional protein RfaE, domain II (TIGR02199; EC 2.7.7.-; HMM-score: 61.5)Biosynthesis of cofactors, prosthetic groups, and carriers Pantothenate and coenzyme A pantetheine-phosphate adenylyltransferase (TIGR01510; EC 2.7.7.3; HMM-score: 29.9)Biosynthesis of cofactors, prosthetic groups, and carriers Pyridine nucleotides nicotinate (nicotinamide) nucleotide adenylyltransferase (TIGR00482; EC 2.7.7.18; HMM-score: 15.2)nicotinamide-nucleotide adenylyltransferase (TIGR01526; EC 2.7.7.1; HMM-score: 13.8)
- TheSEED: see SACOL0698
- PFAM: HUP (CL0039) CTP_transf_like; Cytidylyltransferase-like (PF01467; HMM-score: 96.4)and 3 moreFAD_syn; FAD synthetase (PF06574; HMM-score: 18.5)Pantoate_ligase; Pantoate-beta-alanine ligase (PF02569; HMM-score: 14.6)HIGH_NTase1_ass; Cytidyltransferase-related C-terminal region (PF16581; HMM-score: 13.1)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic
- Cytoplasmic Score: 9.97
- Cytoplasmic Membrane Score: 0
- Cellwall Score: 0.01
- Extracellular Score: 0.02
- Internal Helices: 0
- DeepLocPro: Cytoplasmic
- Cytoplasmic Score: 0.9933
- Cytoplasmic Membrane Score: 0.0002
- Cell wall & surface Score: 0
- Extracellular Score: 0.0065
- LocateP:
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.003818
- TAT(Tat/SPI): 0.00017
- LIPO(Sec/SPII): 0.000723
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Protein sequence[edit | edit source]
- MKRVITYGTYDLLHYGHIELLRRAREMGDYLIVALSTDEFNQIKHKKSYYDYEQRKMMLESIRYVDLVIPEKGWGQKEDDVEKFDVDVFVMGHDWEGEFDFLKDKCEVIYLKRTEGISTTKIKQELYGKDAK
⊟Experimental data[edit | edit source]
- experimentally validated: see SACOL0698
- protein localization: see SACOL0698
- quantitative data / protein copy number per cell: see SACOL0698
- interaction partners:
SACOL_RS03080 elongation factor Tu [1] (data from MRSA252) SACOL_RS05165 NAD(+) kinase [1] (data from MRSA252) SACOL_RS05630 pyruvate dehydrogenase E1 component subunit alpha [1] (data from MRSA252) SACOL_RS05635 pyruvate dehydrogenase E1 component subunit beta [1] (data from MRSA252) SACOL_RS05640 dihydrolipoyllysine-residue acetyltransferase component of pyruvate dehydrogenase complex [1] (data from MRSA252)
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
⊟Regulation[edit | edit source]
- regulator:
⊟Additional information (user-provided)[edit | edit source]
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
- Aureolib: no data available
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Other information (user-provided)[edit | edit source]
You can add further information about the gene and protein here. [edit]
⊟Literature[edit | edit source]
⊟References[edit | edit source]
- ↑ 1.0 1.1 1.2 1.3 1.4 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
J Proteome Res: 2011, 10(3);1139-50
[PubMed:21166474] [WorldCat.org] [DOI] (I p)