From AureoWiki
Jump to navigation Jump to search

NCBI: 02-MAR-2017

Summary[edit | edit source]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL_RS11035 [old locus tag: SACOL2109 ]
  • pan locus tag?: SAUPAN005408000
  • symbol: SACOL_RS11035
  • pan gene symbol?: prmC
  • synonym:
  • product: protein-(glutamine-N5) methyltransferase, release factor-specific

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SACOL_RS11035 [old locus tag: SACOL2109 ]
  • symbol: SACOL_RS11035
  • product: protein-(glutamine-N5) methyltransferase, release factor-specific
  • replicon: chromosome
  • strand: -
  • coordinates: 2169032..2169868
  • length: 837
  • essential: unknown

Accession numbers[edit | edit source]

  • Location: NC_002951 (2169032..2169868) NCBI
  • BioCyc: G1G4B-2318 BioCyc
  • MicrobesOnline:

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    ATGGTGAATTATAAAGAAAAGTTAGATGAAGCAATTCATTTAACACAACAAAAAGGGTTT
    GAACAAACACGAGCTGAATGGTTAATGTTAGATGTATTTCAATGGACGCGTACGGACTTT
    GTAGTCCACATGCATGATGATATGCCGAAAGCGATGATTATGAAGTTCGACTTAGCATTA
    CAACGTATGTTATTAGGAGAGCCTATACAGTATATAGTTGGCTTTGCCTCATTTTATGGT
    AGAACGTTTGATGTAAACTCAAATTGTTTGATACCAAGGCCTGAAACTGAAGAAGTAATG
    TTGCATTTCTTACAACAGTTAGAAGATGATGCAACAATCGTAGATATCGGAACGGGTAGT
    GGTGTACTTGCAATTACTTTGAAATGTGAAAAGCCGGATTTAAATGTTATTGCTACTGAT
    ATTTCACTTGAAGCAATGAATATGGCTCGTAATAATGCTGAGAAGCATCAATCACAAATA
    CAATTTTTAACAGGGGATGCATTAAAGCCCTTAATTAATGAAGGTATCAAGTTGAACGGC
    TTGATATCTAATCCACCATATATAGATGAAAAAGATATGGTTACGATGTCTCCAACGGTT
    ACGAGATTCGAACCACATCAGGCATTGTTTGCAGATAACCATGGATATGCTATTTATGAA
    TCAATCATTGAAGATTTACCTCACGTTATGGAAAAAGGCAGCCCAGTTGTTTTTGAAATT
    GGTTACAATCAAGGTGAGGCACTTAAATCAATAATTTTAAATAAATTTCCTGACAAAAAA
    ATCGACATTATTAAAGATATAAATGGCCACGATCGAATCGTCTCATTTAAATGGTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    837

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SACOL_RS11035 [old locus tag: SACOL2109 ]
  • symbol: SACOL_RS11035
  • description: protein-(glutamine-N5) methyltransferase, release factor-specific
  • length: 278
  • theoretical pI: 4.76327
  • theoretical MW: 31730.3
  • GRAVY: -0.191727

Function[edit | edit source]

  • reaction:
    EC 2.1.1.297?  ExPASy
    Peptide chain release factor N5-glutamine methyltransferase S-adenosyl-L-methionine + [peptide chain release factor 1 or 2]-L-glutamine = S-adenosyl-L-homocysteine + [peptide chain release factor 1 or 2]-N5-methyl-L-glutamine
  • TIGRFAM:
    Genetic information processing Protein fate Protein modification and repair protein-(glutamine-N5) methyltransferase, release factor-specific (TIGR03534; EC 2.1.1.-; HMM-score: 259.5)
    and 20 more
    Genetic information processing Protein fate Protein modification and repair methyltransferase, HemK family (TIGR00536; HMM-score: 207)
    Genetic information processing Protein synthesis Ribosomal proteins: synthesis and modification protein-(glutamine-N5) methyltransferase, ribosomal protein L3-specific (TIGR03533; EC 2.1.1.-; HMM-score: 114.9)
    Genetic information processing Protein synthesis Ribosomal proteins: synthesis and modification putative protein-(glutamine-N5) methyltransferase, unknown substrate-specific (TIGR03704; EC 2.1.1.-; HMM-score: 71.4)
    Unknown function Enzymes of unknown specificity putative methylase (TIGR00537; HMM-score: 47.4)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Heme, porphyrin, and cobalamin precorrin-6Y C5,15-methyltransferase (decarboxylating), CbiT subunit (TIGR02469; EC 2.1.1.132; HMM-score: 32.8)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Menaquinone and ubiquinone ubiquinone/menaquinone biosynthesis methyltransferase (TIGR01934; EC 2.1.1.-; HMM-score: 31.6)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Biotin malonyl-acyl carrier protein O-methyltransferase BioC (TIGR02072; EC 2.1.1.-; HMM-score: 28.7)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Chlorophyll and bacteriochlorphyll magnesium protoporphyrin O-methyltransferase (TIGR02021; EC 2.1.1.11; HMM-score: 27.4)
    Genetic information processing Protein synthesis Ribosomal proteins: synthesis and modification ribosomal protein L11 methyltransferase (TIGR00406; EC 2.1.1.-; HMM-score: 26.8)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Menaquinone and ubiquinone 3-demethylubiquinone-9 3-O-methyltransferase (TIGR01983; EC 2.1.1.64; HMM-score: 23.4)
    Genetic information processing Protein synthesis tRNA and rRNA base modification ribosomal RNA small subunit methyltransferase A (TIGR00755; EC 2.1.1.182; HMM-score: 23)
    Genetic information processing Protein synthesis tRNA and rRNA base modification tRNA (guanine-N(7)-)-methyltransferase (TIGR00091; EC 2.1.1.33; HMM-score: 20.7)
    Genetic information processing Protein synthesis tRNA and rRNA base modification 23S rRNA (uracil-5-)-methyltransferase RumA (TIGR00479; EC 2.1.1.-; HMM-score: 18.7)
    Genetic information processing Protein fate Protein modification and repair protein-L-isoaspartate O-methyltransferase (TIGR00080; EC 2.1.1.77; HMM-score: 15.1)
    Genetic information processing Protein synthesis tRNA and rRNA base modification 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG (TIGR00138; EC 2.1.1.170; HMM-score: 13.9)
    Genetic information processing Transcription RNA processing 3' terminal RNA ribose 2'-O-methyltransferase Hen1 (TIGR04074; EC 2.1.1.-; HMM-score: 13.9)
    Genetic information processing Protein synthesis tRNA and rRNA base modification 3' terminal RNA ribose 2'-O-methyltransferase Hen1 (TIGR04074; EC 2.1.1.-; HMM-score: 13.9)
    2-ketoarginine methyltransferase (TIGR04543; EC 2.1.1.243; HMM-score: 13.2)
    Cell structure Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides putative sugar O-methyltransferase (TIGR04371; EC 2.1.1.-; HMM-score: 11.6)
    Genetic information processing Protein synthesis tRNA and rRNA base modification 23S rRNA (uracil-5-)-methyltransferase RumB (TIGR02085; EC 2.1.1.189; HMM-score: 10.8)
  • TheSEED:
  • PFAM:
    NADP_Rossmann (CL0063) MTS; Methyltransferase small domain (PF05175; HMM-score: 57.7)
    and 18 more
    Methyltransf_25; Methyltransferase domain (PF13649; HMM-score: 34.6)
    Methyltransf_18; Methyltransferase domain (PF12847; HMM-score: 34.4)
    Methyltransf_31; Methyltransferase domain (PF13847; HMM-score: 34.1)
    PrmA; Ribosomal protein L11 methyltransferase (PrmA) (PF06325; HMM-score: 31.8)
    PCMT; Protein-L-isoaspartate(D-aspartate) O-methyltransferase (PCMT) (PF01135; HMM-score: 26)
    Methyltransf_12; Methyltransferase domain (PF08242; HMM-score: 24)
    Methyltransf_4; Putative methyltransferase (PF02390; HMM-score: 23.9)
    Methyltransf_11; Methyltransferase domain (PF08241; HMM-score: 22)
    Methyltransf_23; Methyltransferase domain (PF13489; HMM-score: 21.5)
    Methyltransf_32; Methyltransferase domain (PF13679; HMM-score: 19.7)
    Methyltransf_2; O-methyltransferase (PF00891; HMM-score: 19.6)
    Methyltransf_16; Lysine methyltransferase (PF10294; HMM-score: 19.1)
    GidB; rRNA small subunit methyltransferase G (PF02527; HMM-score: 17.5)
    CmcI; Cephalosporin hydroxylase (PF04989; HMM-score: 16.8)
    Methyltransf_15; RNA cap guanine-N2 methyltransferase (PF09445; HMM-score: 16.6)
    TrmK; tRNA (adenine(22)-N(1))-methyltransferase (PF04816; HMM-score: 16.1)
    UPF0020; Putative RNA methylase family UPF0020 (PF01170; HMM-score: 13.8)
    CMAS; Mycolic acid cyclopropane synthetase (PF02353; HMM-score: 12.7)

Structure, modifications & interactions[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.001389
    • TAT(Tat/SPI): 0.000134
    • LIPO(Sec/SPII): 0.000249
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

  • GI: 446170880 NCBI
  • RefSeq: WP_000248735 NCBI
  • UniProt:

Protein sequence[edit | edit source]

  • MVNYKEKLDEAIHLTQQKGFEQTRAEWLMLDVFQWTRTDFVVHMHDDMPKAMIMKFDLALQRMLLGEPIQYIVGFASFYGRTFDVNSNCLIPRPETEEVMLHFLQQLEDDATIVDIGTGSGVLAITLKCEKPDLNVIATDISLEAMNMARNNAEKHQSQIQFLTGDALKPLINEGIKLNGLISNPPYIDEKDMVTMSPTVTRFEPHQALFADNHGYAIYESIIEDLPHVMEKGSPVVFEIGYNQGEALKSIILNKFPDKKIDIIKDINGHDRIVSFKW

Experimental data[edit | edit source]

  • experimentally validated: no data available

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

Relevant publications[edit | edit source]