From AureoWiki
Jump to navigation Jump to search

NCBI: 02-MAR-2017

Summary[edit | edit source]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL_RS14160 [old locus tag: SACOL2707 ]
  • pan locus tag?: SAUPAN006439000
  • symbol: SACOL_RS14160
  • pan gene symbol?:
  • synonym:
  • product: energy-coupling factor transporter transmembrane protein EcfT

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SACOL_RS14160 [old locus tag: SACOL2707 ]
  • symbol: SACOL_RS14160
  • product: energy-coupling factor transporter transmembrane protein EcfT
  • replicon: chromosome
  • strand: -
  • coordinates: 2779276..2780109
  • length: 834
  • essential: unknown

Accession numbers[edit | edit source]

  • Location: NC_002951 (2779276..2780109) NCBI
  • BioCyc: G1G4B-2961 BioCyc
  • MicrobesOnline:

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    ATGAATCAATATAATACTATAGGTTTTCACCCGGGAAATAGTCGTATTCATCAATTAAAT
    GCGACTGTTAAACTTTTATTCTTATTAGTTGTTTCTATTTCTGCAATGGTGACTTATGAC
    ACAAGATATTTAATTTTAATTAGTGCTTCATCTATTTTATTGGTCAAATATGCTCATATT
    GAATGGAAACAAGTTCGCTTTGTTGTTAAATTCATTCTGTTTTTCACAATATTAAATATT
    ATTGCCGTGTACATATTTGACCCTGAATATGGTGTGAAGATTTATAATCAGCGTACAGAG
    TTAGTCAATGGTATTGGTCGATTTACGCTAACATCACAGGAATTATTCTATCTTTTTAAT
    CTAATATTAAAATATATTAGTACAGTTCCTTTAGCGTTAATATTTTTATTCACAACGAAT
    CCGAGTCATTTTGCTGCAAGTTTAAATCAGCTAGGTGTGAATTATAAAATCAGTTACGCA
    GTCTCACTAGCATTAAGGTATATTCCAGATATTCAAGAAACATATTTTAATATTTCACAA
    GCGCAACAAGCAAGAGGATATGATAATTCGAAAAAAGCAAAATTTACTAGCCGTGTTAAA
    GGTATCAAACGCATTGTGTTACCTTTAATATTTTCTAGTATCGAAAGAATTGACACTATT
    AGTACTGCTATGGAGTTAAGACAATTCGGACAGTATAAAAGGAGAACCTGGTACGTCAAA
    AAACAATTAAAAAAAGATGATTATGTTGTTTTGTGTTTGACGTTAATACTTCTGATGTTA
    GTAGTTACATTATTCTTTTTAAATAATAGTCGATATTTCAACCCGTGGCATTAG
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    834

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SACOL_RS14160 [old locus tag: SACOL2707 ]
  • symbol: SACOL_RS14160
  • description: energy-coupling factor transporter transmembrane protein EcfT
  • length: 277
  • theoretical pI: 10.2899
  • theoretical MW: 32323.8
  • GRAVY: 0.280866

Function[edit | edit source]

  • TIGRFAM:
    Metabolism Transport and binding proteins Cations and iron carrying compounds cobalt ECF transporter T component CbiQ (TIGR02454; HMM-score: 74.6)
  • TheSEED:
  • PFAM:
    no clan defined CbiQ; Cobalt transport protein (PF02361; HMM-score: 106.7)
    and 1 more
    ABC-2 (CL0181) PDR_CDR; CDR ABC transporter (PF06422; HMM-score: 10.7)

Structure, modifications & interactions[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic Membrane
    • Cytoplasmic Score: 0
    • Cytoplasmic Membrane Score: 10
    • Cellwall Score: 0
    • Extracellular Score: 0
    • Internal Helices: 3
  • LocateP:
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.017753
    • TAT(Tat/SPI): 0.00042
    • LIPO(Sec/SPII): 0.009906
  • predicted transmembrane helices (TMHMM): 5

Accession numbers[edit | edit source]

  • GI: 447000570 NCBI
  • RefSeq: WP_001077826 NCBI
  • UniProt:

Protein sequence[edit | edit source]

  • MNQYNTIGFHPGNSRIHQLNATVKLLFLLVVSISAMVTYDTRYLILISASSILLVKYAHIEWKQVRFVVKFILFFTILNIIAVYIFDPEYGVKIYNQRTELVNGIGRFTLTSQELFYLFNLILKYISTVPLALIFLFTTNPSHFAASLNQLGVNYKISYAVSLALRYIPDIQETYFNISQAQQARGYDNSKKAKFTSRVKGIKRIVLPLIFSSIERIDTISTAMELRQFGQYKRRTWYVKKQLKKDDYVVLCLTLILLMLVVTLFFLNNSRYFNPWH

Experimental data[edit | edit source]

  • experimentally validated: no data available

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

Relevant publications[edit | edit source]