From AureoWiki
Jump to navigation Jump to search

NCBI: 03-AUG-2016

Summary[edit | edit source]

  • organism: Staphylococcus aureus NCTC8325
  • locus tag: SAOUHSC_00364
  • pan locus tag?: SAUPAN001981000
  • symbol: SAOUHSC_00364
  • pan gene symbol?: ahpF
  • synonym:
  • product: alkyl hydroperoxide reductase subunit F

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SAOUHSC_00364
  • symbol: SAOUHSC_00364
  • product: alkyl hydroperoxide reductase subunit F
  • replicon: chromosome
  • strand: -
  • coordinates: 369729..371252
  • length: 1524
  • essential: no DEG other strains

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    1381
    1441
    1501
    ATGCTTAATGCTGATTTAAAACAACAACTTAAACAACTATTAGAACTAATGGAGGGCAAC
    GTTGAATTCGTTGCCAGCCTTGGTTCAGATGATAAATCCAAAGAACTTAAAGATTTGTTG
    ACAGAAATTACTGATATGTCACCTAGACTATCTCTTTCTGAAAAATCTTTAAAACGTACA
    CCAAGTTTCTCAGTCAATCGTCCTGGCGAAGAAACAGGTGTAACATTTGCAGGTATTCCA
    TTAGGTCACGAGTTTAACTCACTTGTTTTAGCAATTTTACAGGTTAGTGGTCGTGCACCT
    AAAGAAAAACAGTCAATCATTGACCAAATTAAAAAATTAGAAGGTTCATTCCATTTTGAA
    ACATTCATTAGTTTAACGTGTCAAAAATGTCCTGATGTCGTTCAAGCACTTAACTTAATG
    AGTGTGATCAACCCTAACATCACGCATTCTATGATTGATGGTGCAGTGTTCCGTGAAGAA
    TCTGAAAACATCATGGCAGTCCCTGCTGTCTTTTTAAATGGCGAAGAATTTGGCAATGGT
    CGTATGACAATCCAAGATATTCTTTCGAAACTAGGCAGTACGGCAGATGCATCTGAGTTT
    GAAAATAAAGAACCTTATGATGTCTTAATCGTTGGTGGTGGTCCTGCTAGTGGTAGTGCA
    GCGATTTACACAGCACGTAAAGGTTTACGTACTGGTATAGTTGCTGATCGTATCGGTGGC
    CAAGTTAATGATACTGCTGGTATTGAGAACTTCATTACTGTTAAAGAAACAACTGGTTCT
    GAATTTTCTTCTAACTTAGCAGCGCACATTGATCAATATGACATTGATGCAATGACAGGT
    ATACGTGCTACAGATATCGAAAAGACTGACGAAGCAATTAAAGTTACGTTAGAAAACGGT
    GCTGTCTTAGAAAGTAAAACAGTCATTATTGCTACTGGTGCAGGTTGGCGTAAGCTAAAC
    ATTCCAGGTGAAGAGCAATTGATTAATAAAGGTGTTGCATTCTGCCCTCACTGTGACGGA
    CCTCTATTTGAAAATAAAGACGTAGCAGTTATCGGTGGCGGTAACTCTGGGGTTGAAGCA
    GCAATTGACCTTGCTGGTATCGTTAATCATGTTACATTATTCGAATTCGCTAGCGAATTA
    AAAGCAGACAACGTGTTACAAGATCGTTTACGTTCTTTATCAAATGTTGATATCAAAACA
    AATGCCAAAACTACTGAAGTTGTCGGAGAAGACCATGTTACAGGTATACGTTACGAAGAC
    ATGAACACCGGCGAAGAACATCTACTTAACTTAGATGGTATCTTTGTTCAAATTGGTTTA
    CTTCCAAACACATCATGGTTAAACGATGCTGTTGAATTAAACGAACGTGGTGAAATTGTG
    ATTGATCGTAACAATAATACGAATGTTCCTGGAATATTTGCTGCTGGCGATGTCACAGAT
    CAGAAGAACAAACAAATTATCATTTCAATGGGCGCTGGTGCAAATGCAGCATTAAATGCC
    TTTGACTATATTATCAGAAACTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380
    1440
    1500
    1524

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SAOUHSC_00364
  • symbol: SAOUHSC_00364
  • description: alkyl hydroperoxide reductase subunit F
  • length: 507
  • theoretical pI: 4.41296
  • theoretical MW: 54720.4
  • GRAVY: -0.126627

Function[edit | edit source]

  • reaction:
    EC 1.6.99.3?  ExPASy
    NADH dehydrogenase NADH + acceptor = NAD+ + reduced acceptor
    EC 1.8.1.-?  ExPASy
  • TIGRFAM:
    Cellular processes Cellular processes Detoxification alkyl hydroperoxide reductase subunit F (TIGR03140; EC 1.8.1.-; HMM-score: 811.1)
    Cellular processes Cellular processes Adaptations to atypical conditions alkyl hydroperoxide reductase subunit F (TIGR03140; EC 1.8.1.-; HMM-score: 811.1)
    and 41 more
    putative alkyl hydroperoxide reductase F subunit (TIGR03143; EC 1.6.4.-; HMM-score: 307.4)
    Metabolism Energy metabolism Electron transport thioredoxin-disulfide reductase (TIGR01292; EC 1.8.1.9; HMM-score: 277.9)
    dihydrolipoyl dehydrogenase (TIGR01350; EC 1.8.1.4; HMM-score: 78.7)
    glutaredoxin-like domain protein (TIGR02187; HMM-score: 74)
    Cellular processes Cellular processes Detoxification mercury(II) reductase (TIGR02053; EC 1.16.1.1; HMM-score: 73.8)
    Unknown function Enzymes of unknown specificity putative bacillithiol system oxidoreductase, YpdA family (TIGR04018; EC 1.8.-.-; HMM-score: 70.9)
    Metabolism Amino acid biosynthesis Glutamate family glutamate synthase (NADPH), homotetrameric (TIGR01316; EC 1.4.1.13; HMM-score: 56.1)
    Cellular processes Cellular processes Detoxification CoA-disulfide reductase (TIGR03385; EC 1.8.1.14; HMM-score: 51.4)
    Metabolism Energy metabolism Electron transport glutathione-disulfide reductase (TIGR01424; EC 1.8.1.7; HMM-score: 50.7)
    Metabolism Energy metabolism Electron transport glutathione-disulfide reductase (TIGR01421; EC 1.8.1.7; HMM-score: 46.5)
    Metabolism Central intermediary metabolism Nitrogen metabolism nitrite reductase [NAD(P)H], large subunit (TIGR02374; EC 1.7.1.4; HMM-score: 44)
    pyridine nucleotide-disulfide oxidoreductase family protein (TIGR03169; HMM-score: 42.2)
    trypanothione-disulfide reductase (TIGR01423; EC 1.8.1.12; HMM-score: 40.8)
    mycothione reductase (TIGR03452; EC 1.8.1.15; HMM-score: 35.3)
    glutamate synthase, NADH/NADPH, small subunit (TIGR01317; EC 1.4.1.-; HMM-score: 33.9)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Chlorophyll and bacteriochlorphyll geranylgeranyl reductase family (TIGR02032; EC 1.3.1.-; HMM-score: 31)
    mycofactocin system FadH/OYE family oxidoreductase 2 (TIGR03997; EC 1.-.-.-; HMM-score: 30)
    glutamate synthase, small subunit (TIGR01318; HMM-score: 29.7)
    putative selenate reductase, YgfK subunit (TIGR03315; HMM-score: 28.9)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Menaquinone and ubiquinone ubiquinone biosynthesis hydroxylase, UbiH/UbiF/VisC/COQ6 family (TIGR01988; EC 1.14.13.-; HMM-score: 25.5)
    Unknown function Enzymes of unknown specificity flavoprotein, HI0933 family (TIGR00275; HMM-score: 25.4)
    thioredoxin and glutathione reductase (TIGR01438; EC 1.6.4.-; HMM-score: 23.9)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Thiamine thiazole biosynthesis enzyme (TIGR00292; HMM-score: 23.1)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Chlorophyll and bacteriochlorphyll geranylgeranyl reductase (TIGR02023; EC 1.3.1.-; HMM-score: 21)
    squalene-associated FAD-dependent desaturase (TIGR03467; HMM-score: 17.8)
    mycofactocin system FadH/OYE family oxidoreductase 1 (TIGR03996; EC 1.-.-.-; HMM-score: 17.8)
    Genetic information processing Protein synthesis tRNA and rRNA base modification tRNA U-34 5-methylaminomethyl-2-thiouridine biosynthesis protein MnmC, C-terminal domain (TIGR03197; HMM-score: 17.6)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Menaquinone and ubiquinone 2-polyprenyl-6-methoxyphenol 4-hydroxylase (TIGR01984; EC 1.14.13.-; HMM-score: 16.9)
    Genetic information processing Protein synthesis tRNA and rRNA base modification tRNA uridine 5-carboxymethylaminomethyl modification enzyme GidA (TIGR00136; HMM-score: 15.8)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Pyridine nucleotides L-aspartate oxidase (TIGR00551; EC 1.4.3.16; HMM-score: 15.5)
    Metabolism Energy metabolism TCA cycle succinate dehydrogenase, flavoprotein subunit (TIGR01816; HMM-score: 15.5)
    Metabolism Energy metabolism Amino acids and amines sarcosine oxidase, alpha subunit family (TIGR01372; HMM-score: 14.6)
    Metabolism Energy metabolism Electron transport flavocytochrome c (TIGR01813; HMM-score: 14.3)
    Metabolism Energy metabolism Anaerobic glycerol-3-phosphate dehydrogenase, anaerobic, B subunit (TIGR03378; EC 1.1.5.3; HMM-score: 12.5)
    lycopene cyclase family protein (TIGR01790; HMM-score: 11.8)
    Metabolism Energy metabolism TCA cycle succinate dehydrogenase or fumarate reductase, flavoprotein subunit (TIGR01812; HMM-score: 11.7)
    Metabolism Energy metabolism Anaerobic succinate dehydrogenase or fumarate reductase, flavoprotein subunit (TIGR01812; HMM-score: 11.7)
    Metabolism Energy metabolism Aerobic succinate dehydrogenase or fumarate reductase, flavoprotein subunit (TIGR01812; HMM-score: 11.7)
    salicylate 1-monooxygenase (TIGR03219; EC 1.14.13.1; HMM-score: 11.5)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Chlorophyll and bacteriochlorphyll geranylgeranyl reductase (TIGR02028; HMM-score: 11.1)
    Metabolism Energy metabolism TCA cycle succinate dehydrogenase or fumarate reductase, flavoprotein subunit (TIGR01811; EC 1.3.99.1; HMM-score: 9.4)
  • TheSEED:  
    Sulfur Metabolism Sulfur Metabolism - no subcategory Thioredoxin-disulfide reductase  Alkyl hydroperoxide reductase protein F (EC 1.6.4.-)
  • PFAM:
    NADP_Rossmann (CL0063) Pyr_redox_2; Pyridine nucleotide-disulphide oxidoreductase (PF07992; HMM-score: 156)
    and 19 more
    Pyr_redox_3; Pyridine nucleotide-disulphide oxidoreductase (PF13738; HMM-score: 88.9)
    Pyr_redox; Pyridine nucleotide-disulphide oxidoreductase (PF00070; HMM-score: 55.5)
    GIDA; Glucose inhibited division protein A (PF01134; HMM-score: 32.1)
    Thioredoxin (CL0172) Thioredoxin_3; Thioredoxin domain (PF13192; HMM-score: 29.7)
    NADP_Rossmann (CL0063) HI0933_like; HI0933-like protein (PF03486; HMM-score: 23.9)
    Thi4; Thi4 family (PF01946; HMM-score: 22.1)
    FAD_binding_2; FAD binding domain (PF00890; HMM-score: 18.6)
    DAO; FAD dependent oxidoreductase (PF01266; HMM-score: 18.6)
    AlaDh_PNT_C; Alanine dehydrogenase/PNT, C-terminal domain (PF01262; HMM-score: 17.5)
    FAD_oxidored; FAD dependent oxidoreductase (PF12831; HMM-score: 17.5)
    FAD_binding_3; FAD binding domain (PF01494; HMM-score: 15.5)
    K_oxygenase; L-lysine 6-monooxygenase (NADPH-requiring) (PF13434; HMM-score: 14.8)
    NAD_binding_9; FAD-NAD(P)-binding (PF13454; HMM-score: 14.5)
    NAD_binding_8; NAD(P)-binding Rossmann-like domain (PF13450; HMM-score: 13.5)
    NAD_binding_7; Putative NAD(P)-binding (PF13241; HMM-score: 13.3)
    Thioredoxin (CL0172) Glutaredoxin; Glutaredoxin (PF00462; HMM-score: 12.5)
    NADP_Rossmann (CL0063) Trp_halogenase; Tryptophan halogenase (PF04820; HMM-score: 12.3)
    Spermine_synth; Spermine/spermidine synthase domain (PF01564; HMM-score: 11.8)
    Lycopene_cycl; Lycopene cyclase protein (PF05834; HMM-score: 11.3)

Structure, modifications & interactions[edit | edit source]

  • domains:
  • modifications:
  • cofactors: FAD
  • effectors:
  • protein partners:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic Membrane
    • Cytoplasmic Score: 1.05
    • Cytoplasmic Membrane Score: 8.78
    • Cellwall Score: 0.08
    • Extracellular Score: 0.09
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 1
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.004512
    • TAT(Tat/SPI): 0.002316
    • LIPO(Sec/SPII): 0.001077
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

Protein sequence[edit | edit source]

  • MLNADLKQQLKQLLELMEGNVEFVASLGSDDKSKELKDLLTEITDMSPRLSLSEKSLKRTPSFSVNRPGEETGVTFAGIPLGHEFNSLVLAILQVSGRAPKEKQSIIDQIKKLEGSFHFETFISLTCQKCPDVVQALNLMSVINPNITHSMIDGAVFREESENIMAVPAVFLNGEEFGNGRMTIQDILSKLGSTADASEFENKEPYDVLIVGGGPASGSAAIYTARKGLRTGIVADRIGGQVNDTAGIENFITVKETTGSEFSSNLAAHIDQYDIDAMTGIRATDIEKTDEAIKVTLENGAVLESKTVIIATGAGWRKLNIPGEEQLINKGVAFCPHCDGPLFENKDVAVIGGGNSGVEAAIDLAGIVNHVTLFEFASELKADNVLQDRLRSLSNVDIKTNAKTTEVVGEDHVTGIRYEDMNTGEEHLLNLDGIFVQIGLLPNTSWLNDAVELNERGEIVIDRNNNTNVPGIFAAGDVTDQKNKQIIISMGAGANAALNAFDYIIRN

Experimental data[edit | edit source]

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator: PerR* (repression) regulon
    PerR(TF)important in Oxidative stress response; RegPrecise    transcription unit transferred from N315 data RegPrecise  

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

  1. Maren Depke, Stephan Michalik, Alexander Rabe, Kristin Surmann, Lars Brinkmann, Nico Jehmlich, Jörg Bernhardt, Michael Hecker, Bernd Wollscheid, Zhi Sun, Robert L Moritz, Uwe Völker, Frank Schmidt
    A peptide resource for the analysis of Staphylococcus aureus in host-pathogen interaction studies.
    Proteomics: 2015, 15(21);3648-61
    [PubMed:26224020] [WorldCat.org] [DOI] (I p)
  2. Stephan Michalik, Maren Depke, Annette Murr, Manuela Gesell Salazar, Ulrike Kusebauch, Zhi Sun, Tanja C Meyer, Kristin Surmann, Henrike Pförtner, Petra Hildebrandt, Stefan Weiss, Laura Marcela Palma Medina, Melanie Gutjahr, Elke Hammer, Dörte Becher, Thomas Pribyl, Sven Hammerschmidt, Eric W Deutsch, Samuel L Bader, Michael Hecker, Robert L Moritz, Ulrike Mäder, Uwe Völker, Frank Schmidt
    A global Staphylococcus aureus proteome resource applied to the in vivo characterization of host-pathogen interactions.
    Sci Rep: 2017, 7(1);9718
    [PubMed:28887440] [WorldCat.org] [DOI] (I e)
  3. Ulrike Mäder, Pierre Nicolas, Maren Depke, Jan Pané-Farré, Michel Debarbouille, Magdalena M van der Kooi-Pol, Cyprien Guérin, Sandra Dérozier, Aurelia Hiron, Hanne Jarmer, Aurélie Leduc, Stephan Michalik, Ewoud Reilman, Marc Schaffer, Frank Schmidt, Philippe Bessières, Philippe Noirot, Michael Hecker, Tarek Msadek, Uwe Völker, Jan Maarten van Dijl
    Staphylococcus aureus Transcriptome Architecture: From Laboratory to Infection-Mimicking Conditions.
    PLoS Genet: 2016, 12(4);e1005962
    [PubMed:27035918] [WorldCat.org] [DOI] (I e)

Relevant publications[edit | edit source]