From AureoWiki
Jump to navigation Jump to search

NCBI: 03-AUG-2016

Summary[edit | edit source]

  • organism: Staphylococcus aureus NCTC8325
  • locus tag: SAOUHSC_00436
  • pan locus tag?: SAUPAN002187000
  • symbol: gltD
  • pan gene symbol?: gltD
  • synonym:
  • product: glutamate synthase subunit beta

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SAOUHSC_00436
  • symbol: gltD
  • product: glutamate synthase subunit beta
  • replicon: chromosome
  • strand: +
  • coordinates: 437849..439312
  • length: 1464
  • essential: no DEG other strains

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    1381
    1441
    ATGGGTGAATTTAAAGGATTTATGAAGTATGACAAACAGTACTTAGGTGAATTATCACTG
    GTAGACCGTTTGAAGCATCATAAAGCATATCAACAACGATTTACTAAAGAAGATGCCTCT
    ATCCAAGGTGCACGATGTATGGATTGTGGAACGCCGTTTTGTCAAACCGGACAACAGTAT
    GGTAGGGAAACAATAGGTTGTCCAATTGGAAACTACATTCCTGAATGGAACGACTTAGTG
    TATCATCAAGATTTTAAAACTGCTTATGAACGCTTAAGCGAAACAAATAACTTTCCTGAC
    TTTACAGGGCGTGTATGTCCTGCACCATGCGAAAGTGCTTGTGTGATGAAGATTAATAGA
    GAATCGATTGCGATTAAAGGTATTGAACGCACAATTATTGATGAAGCTTTTGAAAATGGT
    TGGGTAGCGCCGAAAGTTCCGAGTCGCCGTAGAGATGAAAAAGTGGCAATCGTTGGAAGC
    GGTCCAGCAGGATTAGCTGCTGCTGAAGAACTTAATCTACTAGGATATCAAGTAACTATT
    TATGAACGTGCTAGAGAATCAGGCGGTTTATTAATGTATGGTATTCCGAATATGAAACTT
    GATAAAGATGTGGTTCGACGTCGTATTAAGTTAATGGAAGAAGCGGGCATTACTTTCATT
    AATGGTGTTGAAGTCGGTGTTGATATTGATAAAGCAACGTTAGAATCTGAGTATGATGCC
    ATTATATTATGTACTGGTGCACAAAAAGGTAGAGATTTACCTTTAGAAGGACGCATGGGT
    GATGGTATACATTTCGCTATGGATTATTTAACTGAACAAACGCAGTTGTTAAATGGAGAA
    ATTGATGATATAACAATAACTGCAAAAGATAAGAATGTCATTATCATTGGTGCTGGTGAT
    ACAGGGGCAGACTGTGTAGCGACAGCATTAAGAGAAAATTGTAAATCGATTGTTCAATTT
    AATAAATATACGAAATTGCCAGAAGCAATTACATTTACAGAAAATGCATCATGGCCTTTA
    GCAATGCCGGTGTTTAAAATGGACTATGCGCACCAAGAGTACGAAGCTAAGTTTGGTAAG
    GAACCACGTGCATATGGTGTTCAAACAATGCGTTACGATGTTGACGATAAAGGACACATA
    CGTGGTTTGTATACTCAAATTTTAGAGCAAGGCGAAAATGGTATGGTCATGAAAGAAGGA
    CCTGAAAGATTTTGGCCTGCTGACCTTGTATTATTATCAATCGGCTTCGAAGGTACAGAA
    CCAACAGTACCGAATGCTTTTAACATTAAAACGGATAGAAATCGAATCGTGGCGGATGAT
    ACAAACTATCAAACTAATAATGAAAAGGTATTTGCTGCTGGAGATGCTAGACGTGGTCAA
    AGTTTAGTTGTATGGGCAATTAAAGAAGGTAGAGGCGTAGCGAAAGCAGTAGATCAGTAT
    TTAGCTAGTAAAGTTTGTGTATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380
    1440
    1464

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SAOUHSC_00436
  • symbol: GltD
  • description: glutamate synthase subunit beta
  • length: 487
  • theoretical pI: 5.04058
  • theoretical MW: 54427.6
  • GRAVY: -0.386242

Function[edit | edit source]

  • reaction:
    EC 1.4.1.13?  ExPASy
    Glutamate synthase (NADPH) 2 L-glutamate + NADP+ = L-glutamine + 2-oxoglutarate + NADPH
  • TIGRFAM:
    glutamate synthase, NADH/NADPH, small subunit (TIGR01317; EC 1.4.1.-; HMM-score: 612.7)
    and 35 more
    glutamate synthase, small subunit (TIGR01318; HMM-score: 284.6)
    Metabolism Amino acid biosynthesis Glutamate family glutamate synthase (NADPH), homotetrameric (TIGR01316; EC 1.4.1.13; HMM-score: 226.3)
    putative selenate reductase, YgfK subunit (TIGR03315; HMM-score: 161.7)
    mycofactocin system FadH/OYE family oxidoreductase 2 (TIGR03997; EC 1.-.-.-; HMM-score: 58.4)
    dihydrolipoyl dehydrogenase (TIGR01350; EC 1.8.1.4; HMM-score: 46.4)
    Metabolism Energy metabolism Electron transport thioredoxin-disulfide reductase (TIGR01292; EC 1.8.1.9; HMM-score: 43.9)
    Cellular processes Cellular processes Detoxification CoA-disulfide reductase (TIGR03385; EC 1.8.1.14; HMM-score: 37.4)
    Unknown function Enzymes of unknown specificity putative bacillithiol system oxidoreductase, YpdA family (TIGR04018; EC 1.8.-.-; HMM-score: 35.7)
    squalene-associated FAD-dependent desaturase (TIGR03467; HMM-score: 30.2)
    Cellular processes Cellular processes Detoxification mercury(II) reductase (TIGR02053; EC 1.16.1.1; HMM-score: 25.8)
    Unknown function Enzymes of unknown specificity flavoprotein, HI0933 family (TIGR00275; HMM-score: 25.1)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Thiamine thiazole biosynthesis enzyme (TIGR00292; HMM-score: 24.4)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Chlorophyll and bacteriochlorphyll geranylgeranyl reductase (TIGR02023; EC 1.3.1.-; HMM-score: 23.5)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Chlorophyll and bacteriochlorphyll geranylgeranyl reductase (TIGR02028; HMM-score: 23.1)
    Metabolism Amino acid biosynthesis Aromatic amino acid family shikimate dehydrogenase (TIGR00507; EC 1.1.1.25; HMM-score: 21.1)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Other phytoene desaturase (TIGR02734; EC 1.14.99.-; HMM-score: 20.3)
    Genetic information processing Protein synthesis tRNA and rRNA base modification tRNA U-34 5-methylaminomethyl-2-thiouridine biosynthesis protein MnmC, C-terminal domain (TIGR03197; HMM-score: 20)
    Metabolism Energy metabolism Amino acids and amines sarcosine oxidase, alpha subunit family (TIGR01372; HMM-score: 19.3)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Chlorophyll and bacteriochlorphyll geranylgeranyl reductase family (TIGR02032; EC 1.3.1.-; HMM-score: 19.2)
    mycofactocin system FadH/OYE family oxidoreductase 1 (TIGR03996; EC 1.-.-.-; HMM-score: 19.2)
    Metabolism Amino acid biosynthesis Other pyrrolysine biosynthesis protein PylD (TIGR03911; HMM-score: 19)
    thioredoxin and glutathione reductase (TIGR01438; EC 1.6.4.-; HMM-score: 18.2)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Other C-3',4' desaturase CrtD (TIGR02733; EC 1.3.99.-; HMM-score: 17.2)
    Metabolism Energy metabolism Electron transport glutathione-disulfide reductase (TIGR01424; EC 1.8.1.7; HMM-score: 17.1)
    Metabolism Energy metabolism Electron transport flavocytochrome c (TIGR01813; HMM-score: 16.8)
    lycopene cyclase family protein (TIGR01790; HMM-score: 15.5)
    9,9'-di-cis-zeta-carotene desaturase (TIGR02732; EC 1.3.5.6; HMM-score: 15)
    Cellular processes Cellular processes Detoxification alkyl hydroperoxide reductase subunit F (TIGR03140; EC 1.8.1.-; HMM-score: 13.2)
    Cellular processes Cellular processes Adaptations to atypical conditions alkyl hydroperoxide reductase subunit F (TIGR03140; EC 1.8.1.-; HMM-score: 13.2)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Menaquinone and ubiquinone ubiquinone biosynthesis hydroxylase, UbiH/UbiF/VisC/COQ6 family (TIGR01988; EC 1.14.13.-; HMM-score: 12.7)
    putative alkyl hydroperoxide reductase F subunit (TIGR03143; EC 1.6.4.-; HMM-score: 12.6)
    FAD dependent oxidoreductase TIGR03364 (TIGR03364; HMM-score: 12.1)
    Metabolism Central intermediary metabolism Nitrogen metabolism nitrite reductase [NAD(P)H], large subunit (TIGR02374; EC 1.7.1.4; HMM-score: 12)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Thiamine glycine oxidase ThiO (TIGR02352; EC 1.4.3.19; HMM-score: 11.9)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Heme, porphyrin, and cobalamin protoporphyrinogen oxidase (TIGR00562; EC 1.3.3.4; HMM-score: 11.7)
  • TheSEED:  
    Amino Acids and Derivatives Glutamine, glutamate, aspartate, asparagine; ammonia assimilation Glutamine, Glutamate, Aspartate and Asparagine Biosynthesis  Glutamate synthase [NADPH] small chain (EC 1.4.1.13)
    and 1 more
    Nitrogen Metabolism Nitrogen Metabolism - no subcategory Ammonia assimilation  Glutamate synthase [NADPH] small chain (EC 1.4.1.13)
  • PFAM:
    NADP_Rossmann (CL0063) Pyr_redox_2; Pyridine nucleotide-disulphide oxidoreductase (PF07992; HMM-score: 104)
    and 24 more
    4Fe-4S (CL0344) Fer4_20; Dihydroprymidine dehydrogenase domain II, 4Fe-4S cluster (PF14691; HMM-score: 83)
    NADP_Rossmann (CL0063) DAO; FAD dependent oxidoreductase (PF01266; HMM-score: 34.5)
    Pyr_redox; Pyridine nucleotide-disulphide oxidoreductase (PF00070; HMM-score: 32.1)
    NAD_binding_8; NAD(P)-binding Rossmann-like domain (PF13450; HMM-score: 31.7)
    Pyr_redox_3; Pyridine nucleotide-disulphide oxidoreductase (PF13738; HMM-score: 28.9)
    FAD_binding_3; FAD binding domain (PF01494; HMM-score: 26.5)
    HI0933_like; HI0933-like protein (PF03486; HMM-score: 25.3)
    Shikimate_DH; Shikimate / quinate 5-dehydrogenase (PF01488; HMM-score: 23.3)
    K_oxygenase; L-lysine 6-monooxygenase (NADPH-requiring) (PF13434; HMM-score: 23.3)
    Thi4; Thi4 family (PF01946; HMM-score: 23)
    AlaDh_PNT_C; Alanine dehydrogenase/PNT, C-terminal domain (PF01262; HMM-score: 21)
    NAD_binding_7; Putative NAD(P)-binding (PF13241; HMM-score: 20.6)
    2-Hacid_dh_C; D-isomer specific 2-hydroxyacid dehydrogenase, NAD binding domain (PF02826; HMM-score: 20)
    FAD_binding_2; FAD binding domain (PF00890; HMM-score: 19.6)
    FMO-like; Flavin-binding monooxygenase-like (PF00743; HMM-score: 17.9)
    GIDA; Glucose inhibited division protein A (PF01134; HMM-score: 17.3)
    FAD_oxidored; FAD dependent oxidoreductase (PF12831; HMM-score: 17)
    YjeF_N; YjeF-related protein N-terminus (PF03853; HMM-score: 16)
    NAD_binding_9; FAD-NAD(P)-binding (PF13454; HMM-score: 14.6)
    no clan defined PALP; Pyridoxal-phosphate dependent enzyme (PF00291; HMM-score: 13.6)
    NADP_Rossmann (CL0063) IlvN; Acetohydroxy acid isomeroreductase, NADPH-binding domain (PF07991; HMM-score: 13.4)
    NAD_Gly3P_dh_N; NAD-dependent glycerol-3-phosphate dehydrogenase N-terminus (PF01210; HMM-score: 12.2)
    3HCDH_N; 3-hydroxyacyl-CoA dehydrogenase, NAD binding domain (PF02737; HMM-score: 12.1)
    Lycopene_cycl; Lycopene cyclase protein (PF05834; HMM-score: 11.1)

Structure, modifications & interactions[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 1
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.069056
    • TAT(Tat/SPI): 0.00348
    • LIPO(Sec/SPII): 0.003297
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

Protein sequence[edit | edit source]

  • MGEFKGFMKYDKQYLGELSLVDRLKHHKAYQQRFTKEDASIQGARCMDCGTPFCQTGQQYGRETIGCPIGNYIPEWNDLVYHQDFKTAYERLSETNNFPDFTGRVCPAPCESACVMKINRESIAIKGIERTIIDEAFENGWVAPKVPSRRRDEKVAIVGSGPAGLAAAEELNLLGYQVTIYERARESGGLLMYGIPNMKLDKDVVRRRIKLMEEAGITFINGVEVGVDIDKATLESEYDAIILCTGAQKGRDLPLEGRMGDGIHFAMDYLTEQTQLLNGEIDDITITAKDKNVIIIGAGDTGADCVATALRENCKSIVQFNKYTKLPEAITFTENASWPLAMPVFKMDYAHQEYEAKFGKEPRAYGVQTMRYDVDDKGHIRGLYTQILEQGENGMVMKEGPERFWPADLVLLSIGFEGTEPTVPNAFNIKTDRNRIVADDTNYQTNNEKVFAAGDARRGQSLVVWAIKEGRGVAKAVDQYLASKVCV

Experimental data[edit | edit source]

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulators: GltC* (activation) regulon, CodY* (repression) regulon
    GltC(TF)important in Glutamate metabolism; RegPrecise    transcription unit transferred from N315 data RegPrecise  
    CodY(TF)important in Amino acid metabolism; RegPrecise    transcription unit transferred from N315 data RegPrecise  

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

  1. Maren Depke, Stephan Michalik, Alexander Rabe, Kristin Surmann, Lars Brinkmann, Nico Jehmlich, Jörg Bernhardt, Michael Hecker, Bernd Wollscheid, Zhi Sun, Robert L Moritz, Uwe Völker, Frank Schmidt
    A peptide resource for the analysis of Staphylococcus aureus in host-pathogen interaction studies.
    Proteomics: 2015, 15(21);3648-61
    [PubMed:26224020] [WorldCat.org] [DOI] (I p)
  2. Stephan Michalik, Maren Depke, Annette Murr, Manuela Gesell Salazar, Ulrike Kusebauch, Zhi Sun, Tanja C Meyer, Kristin Surmann, Henrike Pförtner, Petra Hildebrandt, Stefan Weiss, Laura Marcela Palma Medina, Melanie Gutjahr, Elke Hammer, Dörte Becher, Thomas Pribyl, Sven Hammerschmidt, Eric W Deutsch, Samuel L Bader, Michael Hecker, Robert L Moritz, Ulrike Mäder, Uwe Völker, Frank Schmidt
    A global Staphylococcus aureus proteome resource applied to the in vivo characterization of host-pathogen interactions.
    Sci Rep: 2017, 7(1);9718
    [PubMed:28887440] [WorldCat.org] [DOI] (I e)
  3. Ulrike Mäder, Pierre Nicolas, Maren Depke, Jan Pané-Farré, Michel Debarbouille, Magdalena M van der Kooi-Pol, Cyprien Guérin, Sandra Dérozier, Aurelia Hiron, Hanne Jarmer, Aurélie Leduc, Stephan Michalik, Ewoud Reilman, Marc Schaffer, Frank Schmidt, Philippe Bessières, Philippe Noirot, Michael Hecker, Tarek Msadek, Uwe Völker, Jan Maarten van Dijl
    Staphylococcus aureus Transcriptome Architecture: From Laboratory to Infection-Mimicking Conditions.
    PLoS Genet: 2016, 12(4);e1005962
    [PubMed:27035918] [WorldCat.org] [DOI] (I e)

Relevant publications[edit | edit source]