From AureoWiki
Jump to navigation Jump to search

NCBI: 03-AUG-2016

Summary[edit | edit source]

  • organism: Staphylococcus aureus NCTC8325
  • locus tag: SAOUHSC_00581
  • pan locus tag?: SAUPAN002375000
  • symbol: SAOUHSC_00581
  • pan gene symbol?:
  • synonym:
  • product: hypothetical protein

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SAOUHSC_00581
  • symbol: SAOUHSC_00581
  • product: hypothetical protein
  • replicon: chromosome
  • strand: -
  • coordinates: 583052..584374
  • length: 1323
  • essential: no DEG other strains

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    ATGAAAACATATGATTTAATTGTAATAGGATTTGGGAAAGCTGGTAAAACTTTAGCGAAA
    TACGCTGCATCAACAGGTCAACACGTCGCAGTTATCGAACAATCTCCGAAAATGTATGGA
    GGCACTTGTATAAACATAGGATGTATACCTTCGAAGACACTTGTACATGATGGATTAGAA
    GGCAAATCTTTTGAAGCAAGTTATAACCGTAAAAACGATGTTGTCAATGCGCTAAACAAT
    AAAAATTACCACTTATTAGCAGACGATAACAACATTGATGTACTGGATTTTAAAGCGCAG
    TTTAAATCTAATACTGAAGTGAATTTATTAGATCAACATGACGATATCGTCGATAGTATT
    ACTGCACCTCATATCATTATTAATACCGGTGCTACCTCTGTCATTCCTAACATTAAAGGC
    CTTGATCAAGCTAAACACGTCTTCGATTCGACAGGTTTATTAAACATTAGCTATCAACCT
    AAGCACCTCGTTATTGTAGGTGGCGGTTATATCGCCTTAGAATTTGCTTCAATGTTTGCG
    AATTTAGGTAGTAAGGTAACAGTATTAGAACGTGGCGAATCATTTATGCCACGCGAAGAT
    CAAGATGTCGTTGCATATGGTATTACTGACTTAGAAAATAAAGGCATTGCATTGCATACA
    AATGTTGAAACGACTGAATTGTCATCTGACAATCATCATACAACAGTCCATACCAACGTT
    GGTAACTTTGAGGCTGATGCAGTACTTTTGGCTATCGGGCGCAAACCGAATACGGATTTA
    GCTTTAGAAAATACTGATATCGAATTAGGCGACAGAGGCGAAATTAAAGTCAATGCTCAT
    CTTCAAACAACTGTGCCGCATATTTATGCTGCAGGTGATGTTAAAGGCGGACTTCAATTT
    ACGTATATATCTTTAGATGATTATCGAATTATCAAATCAGCGTTATATGGTAATCAGTCA
    CGTACGACTGACAATAGAGGCAGCGTGCCTTATACAGTATTTATAGATCCACCATTATCA
    CGTGTTGGATTAACTAGTAAAGAAGCTGCCGCTCAACATTATGATTACACTGAACATCAA
    CTTTTAGTAAGTGCTATACCTCGTCATAAAATTAACAATGATCCAAGAGGTTTATTTAAA
    GTAGTCATTAATAATGAAAATAATATGATTTTAGGTGCTACATTATATGGTAAGCAATCT
    GAAGAATTAATTAATATAATTAAACTTGCGATTGATCAAAACATTCCATATACCGTATTA
    CGAGATAATATTTATACGCATCCTACGATGGCCGAATCATTTAATGATTTATTTAATTTC
    TAG
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1323

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SAOUHSC_00581
  • symbol: SAOUHSC_00581
  • description: hypothetical protein
  • length: 440
  • theoretical pI: 5.79556
  • theoretical MW: 48415.2
  • GRAVY: -0.227273

Function[edit | edit source]

  • TIGRFAM:
    dihydrolipoyl dehydrogenase (TIGR01350; EC 1.8.1.4; HMM-score: 319.2)
    Cellular processes Cellular processes Detoxification mercury(II) reductase (TIGR02053; EC 1.16.1.1; HMM-score: 307.7)
    and 39 more
    Metabolism Energy metabolism Electron transport glutathione-disulfide reductase (TIGR01424; EC 1.8.1.7; HMM-score: 241)
    mycothione reductase (TIGR03452; EC 1.8.1.15; HMM-score: 205.3)
    Metabolism Energy metabolism Electron transport glutathione-disulfide reductase (TIGR01421; EC 1.8.1.7; HMM-score: 203.5)
    thioredoxin and glutathione reductase (TIGR01438; EC 1.6.4.-; HMM-score: 159.5)
    trypanothione-disulfide reductase (TIGR01423; EC 1.8.1.12; HMM-score: 151)
    Cellular processes Cellular processes Detoxification CoA-disulfide reductase (TIGR03385; EC 1.8.1.14; HMM-score: 120.4)
    Metabolism Central intermediary metabolism Nitrogen metabolism nitrite reductase [NAD(P)H], large subunit (TIGR02374; EC 1.7.1.4; HMM-score: 90.2)
    Metabolism Energy metabolism Electron transport thioredoxin-disulfide reductase (TIGR01292; EC 1.8.1.9; HMM-score: 75.5)
    Cellular processes Cellular processes Detoxification alkyl hydroperoxide reductase subunit F (TIGR03140; EC 1.8.1.-; HMM-score: 59.4)
    Cellular processes Cellular processes Adaptations to atypical conditions alkyl hydroperoxide reductase subunit F (TIGR03140; EC 1.8.1.-; HMM-score: 59.4)
    Metabolism Amino acid biosynthesis Glutamate family glutamate synthase (NADPH), homotetrameric (TIGR01316; EC 1.4.1.13; HMM-score: 57.1)
    pyridine nucleotide-disulfide oxidoreductase family protein (TIGR03169; HMM-score: 49.1)
    Unknown function Enzymes of unknown specificity putative bacillithiol system oxidoreductase, YpdA family (TIGR04018; EC 1.8.-.-; HMM-score: 47.5)
    putative alkyl hydroperoxide reductase F subunit (TIGR03143; EC 1.6.4.-; HMM-score: 47)
    putative selenate reductase, YgfK subunit (TIGR03315; HMM-score: 39)
    FAD dependent oxidoreductase TIGR03364 (TIGR03364; HMM-score: 39)
    Unknown function Enzymes of unknown specificity flavoprotein, HI0933 family (TIGR00275; HMM-score: 37.9)
    glutamate synthase, NADH/NADPH, small subunit (TIGR01317; EC 1.4.1.-; HMM-score: 32.6)
    glutamate synthase, small subunit (TIGR01318; HMM-score: 31.5)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Chlorophyll and bacteriochlorphyll geranylgeranyl reductase family (TIGR02032; EC 1.3.1.-; HMM-score: 30.7)
    mycofactocin system FadH/OYE family oxidoreductase 2 (TIGR03997; EC 1.-.-.-; HMM-score: 27.7)
    Genetic information processing Protein synthesis tRNA and rRNA base modification tRNA U-34 5-methylaminomethyl-2-thiouridine biosynthesis protein MnmC, C-terminal domain (TIGR03197; HMM-score: 25)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Thiamine thiazole biosynthesis enzyme (TIGR00292; HMM-score: 23.2)
    squalene-associated FAD-dependent desaturase (TIGR03467; HMM-score: 20.2)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Thiamine glycine oxidase ThiO (TIGR02352; EC 1.4.3.19; HMM-score: 19.6)
    Cell structure Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides UDP-galactopyranose mutase (TIGR00031; EC 5.4.99.9; HMM-score: 17.9)
    nucleotide sugar dehydrogenase (TIGR03026; HMM-score: 17)
    Genetic information processing Protein fate Protein folding and stabilization xanthine dehydrogenase accessory protein XdhC (TIGR02964; HMM-score: 16.8)
    Metabolism Purines, pyrimidines, nucleosides, and nucleotides Other xanthine dehydrogenase accessory protein XdhC (TIGR02964; HMM-score: 16.8)
    Metabolism Amino acid biosynthesis Other pyrrolysine biosynthesis protein PylD (TIGR03911; HMM-score: 16.5)
    Cellular processes Cellular processes Sporulation and germination dipicolinic acid synthetase, A subunit (TIGR02853; HMM-score: 16)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Other C-3',4' desaturase CrtD (TIGR02733; EC 1.3.99.-; HMM-score: 15.1)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Pyridine nucleotides L-aspartate oxidase (TIGR00551; EC 1.4.3.16; HMM-score: 14.6)
    Metabolism Energy metabolism Amino acids and amines sarcosine oxidase, alpha subunit family (TIGR01372; HMM-score: 14)
    Metabolism Energy metabolism Electron transport flavocytochrome c (TIGR01813; HMM-score: 13.9)
    Metabolism Energy metabolism Amino acids and amines alanine dehydrogenase (TIGR00518; EC 1.4.1.1; HMM-score: 13.6)
    mycofactocin system FadH/OYE family oxidoreductase 1 (TIGR03996; EC 1.-.-.-; HMM-score: 13.1)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Other phytoene desaturase (TIGR02734; EC 1.14.99.-; HMM-score: 12.8)
    lycopene cyclase family protein (TIGR01790; HMM-score: 12.7)
  • TheSEED:  
    Carbohydrates Central carbohydrate metabolism acinetobacter tca  Putative Dihydrolipoamide dehydrogenase (EC 1.8.1.4)
    and 4 more
    TCA Cycle  Putative Dihydrolipoamide dehydrogenase (EC 1.8.1.4)
    Virulence, Disease and Defense Resistance to antibiotics and toxic compounds Mercuric reductase  Mercuric ion reductase (EC 1.16.1.1)
    PF00070 family, FAD-dependent NAD(P)-disulphide oxidoreductase
    Mercury resistance operon  Mercuric ion reductase (EC 1.16.1.1)
  • PFAM:
    NADP_Rossmann (CL0063) Pyr_redox_2; Pyridine nucleotide-disulphide oxidoreductase (PF07992; HMM-score: 202.5)
    and 21 more
    Reductase_C (CL0608) Pyr_redox_dim; Pyridine nucleotide-disulphide oxidoreductase, dimerisation domain (PF02852; HMM-score: 81.9)
    NADP_Rossmann (CL0063) Pyr_redox; Pyridine nucleotide-disulphide oxidoreductase (PF00070; HMM-score: 80.3)
    Pyr_redox_3; Pyridine nucleotide-disulphide oxidoreductase (PF13738; HMM-score: 54)
    HI0933_like; HI0933-like protein (PF03486; HMM-score: 33.7)
    K_oxygenase; L-lysine 6-monooxygenase (NADPH-requiring) (PF13434; HMM-score: 29.3)
    DAO; FAD dependent oxidoreductase (PF01266; HMM-score: 27.1)
    NAD_binding_7; Putative NAD(P)-binding (PF13241; HMM-score: 27)
    XdhC_C; XdhC Rossmann domain (PF13478; HMM-score: 26.9)
    2-Hacid_dh_C; D-isomer specific 2-hydroxyacid dehydrogenase, NAD binding domain (PF02826; HMM-score: 24.9)
    TrkA_N; TrkA-N domain (PF02254; HMM-score: 23.9)
    NAD_binding_8; NAD(P)-binding Rossmann-like domain (PF13450; HMM-score: 23.7)
    3HCDH_N; 3-hydroxyacyl-CoA dehydrogenase, NAD binding domain (PF02737; HMM-score: 22.7)
    Lycopene_cycl; Lycopene cyclase protein (PF05834; HMM-score: 21.7)
    GIDA; Glucose inhibited division protein A (PF01134; HMM-score: 21.4)
    Thi4; Thi4 family (PF01946; HMM-score: 20.9)
    AlaDh_PNT_C; Alanine dehydrogenase/PNT, C-terminal domain (PF01262; HMM-score: 19.9)
    FAD_binding_2; FAD binding domain (PF00890; HMM-score: 19.4)
    F420_oxidored; NADP oxidoreductase coenzyme F420-dependent (PF03807; HMM-score: 17.6)
    UDPG_MGDP_dh_N; UDP-glucose/GDP-mannose dehydrogenase family, NAD binding domain (PF03721; HMM-score: 16.3)
    Sacchrp_dh_NADP; Saccharopine dehydrogenase NADP binding domain (PF03435; HMM-score: 13.5)
    no clan defined DUF2704; Protein of unknown function (DUF2704) (PF10866; HMM-score: 12.9)

Structure, modifications & interactions[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 1
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.166332
    • TAT(Tat/SPI): 0.013324
    • LIPO(Sec/SPII): 0.030263
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

Protein sequence[edit | edit source]

  • MKTYDLIVIGFGKAGKTLAKYAASTGQHVAVIEQSPKMYGGTCINIGCIPSKTLVHDGLEGKSFEASYNRKNDVVNALNNKNYHLLADDNNIDVLDFKAQFKSNTEVNLLDQHDDIVDSITAPHIIINTGATSVIPNIKGLDQAKHVFDSTGLLNISYQPKHLVIVGGGYIALEFASMFANLGSKVTVLERGESFMPREDQDVVAYGITDLENKGIALHTNVETTELSSDNHHTTVHTNVGNFEADAVLLAIGRKPNTDLALENTDIELGDRGEIKVNAHLQTTVPHIYAAGDVKGGLQFTYISLDDYRIIKSALYGNQSRTTDNRGSVPYTVFIDPPLSRVGLTSKEAAAQHYDYTEHQLLVSAIPRHKINNDPRGLFKVVINNENNMILGATLYGKQSEELINIIKLAIDQNIPYTVLRDNIYTHPTMAESFNDLFNF

Experimental data[edit | edit source]

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

  1. Maren Depke, Stephan Michalik, Alexander Rabe, Kristin Surmann, Lars Brinkmann, Nico Jehmlich, Jörg Bernhardt, Michael Hecker, Bernd Wollscheid, Zhi Sun, Robert L Moritz, Uwe Völker, Frank Schmidt
    A peptide resource for the analysis of Staphylococcus aureus in host-pathogen interaction studies.
    Proteomics: 2015, 15(21);3648-61
    [PubMed:26224020] [WorldCat.org] [DOI] (I p)
  2. Stephan Michalik, Maren Depke, Annette Murr, Manuela Gesell Salazar, Ulrike Kusebauch, Zhi Sun, Tanja C Meyer, Kristin Surmann, Henrike Pförtner, Petra Hildebrandt, Stefan Weiss, Laura Marcela Palma Medina, Melanie Gutjahr, Elke Hammer, Dörte Becher, Thomas Pribyl, Sven Hammerschmidt, Eric W Deutsch, Samuel L Bader, Michael Hecker, Robert L Moritz, Ulrike Mäder, Uwe Völker, Frank Schmidt
    A global Staphylococcus aureus proteome resource applied to the in vivo characterization of host-pathogen interactions.
    Sci Rep: 2017, 7(1);9718
    [PubMed:28887440] [WorldCat.org] [DOI] (I e)
  3. Ulrike Mäder, Pierre Nicolas, Maren Depke, Jan Pané-Farré, Michel Debarbouille, Magdalena M van der Kooi-Pol, Cyprien Guérin, Sandra Dérozier, Aurelia Hiron, Hanne Jarmer, Aurélie Leduc, Stephan Michalik, Ewoud Reilman, Marc Schaffer, Frank Schmidt, Philippe Bessières, Philippe Noirot, Michael Hecker, Tarek Msadek, Uwe Völker, Jan Maarten van Dijl
    Staphylococcus aureus Transcriptome Architecture: From Laboratory to Infection-Mimicking Conditions.
    PLoS Genet: 2016, 12(4);e1005962
    [PubMed:27035918] [WorldCat.org] [DOI] (I e)

Relevant publications[edit | edit source]