From AureoWiki
Jump to navigation Jump to search

NCBI: 03-AUG-2016

Summary[edit | edit source]

  • organism: Staphylococcus aureus NCTC8325
  • locus tag: SAOUHSC_00989
  • pan locus tag?: SAUPAN003254000
  • symbol: SAOUHSC_00989
  • pan gene symbol?: patA
  • synonym:
  • product: hypothetical protein

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SAOUHSC_00989
  • symbol: SAOUHSC_00989
  • product: hypothetical protein
  • replicon: chromosome
  • strand: -
  • coordinates: 960954..962108
  • length: 1155
  • essential: no DEG other strains

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    ATGAAACTTTCTTTAAATTCTAATTCTAAATATTTAAGAGCACCAAGTATTCGCCAATTT
    TCAAATCGTATGAATAATTTGGATGATTGTGTTAATTTAACTATTGGCCAACCAGACTTC
    CCGATGCCTGATGTTGTGAAAAAGGCATATATTGATGCTATTAACAATGACAAGACATCA
    TACTCTCACAATAAAGGGTTATTAGAAACTCGCGAAGCAATTAGTCAATACTTCAAAAAT
    CGTTATCATTTTTCCTATGATCCTGAAGAAATTATTGTGACAAATGGAGCAAGTGAAGCA
    ATAGACACAACGTTACGTTCTATCATAGAGCCTGGAGATGAAATTATAATACCGGGACCA
    ATTTATGCAGGCTACATACCACTCATCGAAGTACTAGGTGGTAAACCAATTTATATTGAT
    ACAACAGCAACACAATTTAAAATTACACCTGATGCATTAGAAAGTCATATTTCTCCAAAG
    ACAAAAGCTGTCTTGTTAAATTATCCGACTAATCCAACTGGCGTAGTTTTAAAAAGAAAT
    GAAGTTTTAAATATCGTAAATGTATTAAAAAAATATCCGTTATTTATTATTAGCGATGAG
    ATTTATGCTGAAAATACATTTAGTGGTAAACATGTATCCTTCGCTGAATTTGAAGACATT
    CGTGATCAATTAATATTAATTGGTGGTTTAAGTAAATCACACTCAGCAACCGGAATAAGA
    ATTGGTTTTCTATTAGGACCTCAATATTTGATTGATAAATTAACATTTATGCACGCCTAT
    AATTGTATTTTTGCCAATGTTCCAGCTCAAATAGCATGTATAACAGCACTTAACGAAGGA
    TTAGAAGCTCCTAAATATATGAACGAAGCTTATGTAGAACGAAGAAATTATTTAGTATCT
    GAATTAACTAAATTAGGTTTTGAGATTACCGCTCAACCTGAAGGCGCGTTTTATATTTTC
    CCAAGTATTAAACATATCACCGATGACGATTTCGAATTTTGTGTCGATTTACTTGAATCA
    ACACATTTAGCAATCGTTCCAGGCTCATCCTTTACAGAATTCGGTAAAGGATTTGTAAGG
    ATTTCCTATGCTTATGAAATGGATGTTTTAAAAGAAGGTATGAAGAGACTTGCTAAATAT
    TTAAATACTAAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1155

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SAOUHSC_00989
  • symbol: SAOUHSC_00989
  • description: hypothetical protein
  • length: 384
  • theoretical pI: 5.66657
  • theoretical MW: 43190.2
  • GRAVY: -0.115365

Function[edit | edit source]

  • reaction:
    EC 2.6.1.-?  ExPASy
  • TIGRFAM:
    LL-diaminopimelate aminotransferase (TIGR03540; EC 2.6.1.83; HMM-score: 209.3)
    and 29 more
    tyrosine/nicotianamine family aminotransferase (TIGR01265; HMM-score: 156.2)
    succinyldiaminopimelate transaminase (TIGR03538; EC 2.6.1.17; HMM-score: 137.3)
    putative C-S lyase (TIGR04350; EC 4.4.-.-; HMM-score: 135.8)
    Metabolism Energy metabolism Amino acids and amines tyrosine aminotransferase (TIGR01264; EC 2.6.1.5; HMM-score: 128.2)
    succinyldiaminopimelate transaminase (TIGR03537; EC 2.6.1.17; HMM-score: 125.3)
    Cellular processes Cellular processes Biosynthesis of natural products capreomycidine synthase (TIGR03947; HMM-score: 124.1)
    succinyldiaminopimelate transaminase (TIGR03539; EC 2.6.1.17; HMM-score: 123.4)
    Metabolism Amino acid biosynthesis Histidine family histidinol-phosphate transaminase (TIGR01141; EC 2.6.1.9; HMM-score: 119.5)
    LL-diaminopimelate aminotransferase (TIGR03542; EC 2.6.1.83; HMM-score: 101.5)
    beta-methylarginine biosynthesis bifunctional aminotransferase (TIGR04544; EC 2.6.-.-; HMM-score: 97.2)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Heme, porphyrin, and cobalamin threonine-phosphate decarboxylase (TIGR01140; EC 4.1.1.81; HMM-score: 84.9)
    enduracididine biosynthesis enzyme MppQ (TIGR04461; EC 2.-.-.-; HMM-score: 52.5)
    Metabolism Energy metabolism Amino acids and amines aspartate 4-decarboxylase (TIGR03801; EC 4.1.1.12; HMM-score: 41.1)
    Cell structure Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides TDP-4-keto-6-deoxy-D-glucose transaminase (TIGR02379; HMM-score: 28)
    Unknown function Enzymes of unknown specificity cysteine desulfurase family protein (TIGR01977; HMM-score: 27.9)
    putative pyridoxal phosphate-dependent acyltransferase (TIGR01825; EC 2.3.1.-; HMM-score: 24.7)
    Metabolism Energy metabolism Amino acids and amines methionine gamma-lyase (TIGR01328; EC 4.4.1.11; HMM-score: 24.4)
    cystathionine beta-lyase (TIGR01329; EC 4.4.1.8; HMM-score: 22.9)
    Metabolism Amino acid biosynthesis Aspartate family O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase (TIGR01326; HMM-score: 17.3)
    Metabolism Amino acid biosynthesis Serine family O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase (TIGR01326; HMM-score: 17.3)
    aminotransferase, LLPSF_NHT_00031 family (TIGR04181; HMM-score: 16.4)
    Metabolism Amino acid biosynthesis Aspartate family O-succinylhomoserine (thiol)-lyase (TIGR02080; EC 2.5.1.48; HMM-score: 15.5)
    Metabolism Energy metabolism Amino acids and amines glycine C-acetyltransferase (TIGR01822; EC 2.3.1.29; HMM-score: 13.6)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Heme, porphyrin, and cobalamin 5-aminolevulinic acid synthase (TIGR01821; EC 2.3.1.37; HMM-score: 13.3)
    Metabolism Amino acid biosynthesis Aspartate family cystathionine beta-lyase (TIGR01324; EC 4.4.1.8; HMM-score: 12.9)
    Genetic information processing DNA metabolism Restriction/modification cysteine desulfurase DndA (TIGR03235; EC 2.8.1.7; HMM-score: 12.9)
    Metabolism Amino acid biosynthesis Aspartate family O-succinylhomoserine sulfhydrylase (TIGR01325; EC 4.2.99.-; HMM-score: 12.6)
    ornithine--oxo-acid transaminase (TIGR01885; EC 2.6.1.13; HMM-score: 12.3)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Other cysteine desulfurase, catalytic subunit CsdA (TIGR03392; EC 2.8.1.7; HMM-score: 11)
  • TheSEED:  
    Amino Acids and Derivatives Lysine, threonine, methionine, and cysteine Lysine Biosynthesis DAP Pathway  N-acetyl-L,L-diaminopimelate aminotransferase (EC 2.6.1.-)
  • PFAM:
    PLP_aminotran (CL0061) Aminotran_1_2; Aminotransferase class I and II (PF00155; HMM-score: 212.1)
    and 4 more
    DegT_DnrJ_EryC1; DegT/DnrJ/EryC1/StrS aminotransferase family (PF01041; HMM-score: 39.9)
    Aminotran_5; Aminotransferase class-V (PF00266; HMM-score: 35.2)
    Cys_Met_Meta_PP; Cys/Met metabolism PLP-dependent enzyme (PF01053; HMM-score: 34.3)
    OKR_DC_1; Orn/Lys/Arg decarboxylase, major domain (PF01276; HMM-score: 18)

Structure, modifications & interactions[edit | edit source]

  • domains:
  • modifications:
  • cofactors: pyridoxal 5'-phosphate
  • effectors:
  • protein partners:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 1
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.010565
    • TAT(Tat/SPI): 0.000464
    • LIPO(Sec/SPII): 0.001211
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

Protein sequence[edit | edit source]

  • MKLSLNSNSKYLRAPSIRQFSNRMNNLDDCVNLTIGQPDFPMPDVVKKAYIDAINNDKTSYSHNKGLLETREAISQYFKNRYHFSYDPEEIIVTNGASEAIDTTLRSIIEPGDEIIIPGPIYAGYIPLIEVLGGKPIYIDTTATQFKITPDALESHISPKTKAVLLNYPTNPTGVVLKRNEVLNIVNVLKKYPLFIISDEIYAENTFSGKHVSFAEFEDIRDQLILIGGLSKSHSATGIRIGFLLGPQYLIDKLTFMHAYNCIFANVPAQIACITALNEGLEAPKYMNEAYVERRNYLVSELTKLGFEITAQPEGAFYIFPSIKHITDDDFEFCVDLLESTHLAIVPGSSFTEFGKGFVRISYAYEMDVLKEGMKRLAKYLNTK

Experimental data[edit | edit source]

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator: CodY* (repression) regulon
    CodY(TF)important in Amino acid metabolism; RegPrecise  

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

  1. Maren Depke, Stephan Michalik, Alexander Rabe, Kristin Surmann, Lars Brinkmann, Nico Jehmlich, Jörg Bernhardt, Michael Hecker, Bernd Wollscheid, Zhi Sun, Robert L Moritz, Uwe Völker, Frank Schmidt
    A peptide resource for the analysis of Staphylococcus aureus in host-pathogen interaction studies.
    Proteomics: 2015, 15(21);3648-61
    [PubMed:26224020] [WorldCat.org] [DOI] (I p)
  2. Stephan Michalik, Maren Depke, Annette Murr, Manuela Gesell Salazar, Ulrike Kusebauch, Zhi Sun, Tanja C Meyer, Kristin Surmann, Henrike Pförtner, Petra Hildebrandt, Stefan Weiss, Laura Marcela Palma Medina, Melanie Gutjahr, Elke Hammer, Dörte Becher, Thomas Pribyl, Sven Hammerschmidt, Eric W Deutsch, Samuel L Bader, Michael Hecker, Robert L Moritz, Ulrike Mäder, Uwe Völker, Frank Schmidt
    A global Staphylococcus aureus proteome resource applied to the in vivo characterization of host-pathogen interactions.
    Sci Rep: 2017, 7(1);9718
    [PubMed:28887440] [WorldCat.org] [DOI] (I e)
  3. Ulrike Mäder, Pierre Nicolas, Maren Depke, Jan Pané-Farré, Michel Debarbouille, Magdalena M van der Kooi-Pol, Cyprien Guérin, Sandra Dérozier, Aurelia Hiron, Hanne Jarmer, Aurélie Leduc, Stephan Michalik, Ewoud Reilman, Marc Schaffer, Frank Schmidt, Philippe Bessières, Philippe Noirot, Michael Hecker, Tarek Msadek, Uwe Völker, Jan Maarten van Dijl
    Staphylococcus aureus Transcriptome Architecture: From Laboratory to Infection-Mimicking Conditions.
    PLoS Genet: 2016, 12(4);e1005962
    [PubMed:27035918] [WorldCat.org] [DOI] (I e)

Relevant publications[edit | edit source]