⊟Summary[edit | edit source]
- organism: Staphylococcus aureus NCTC8325
- locus tag: SAOUHSC_01082
- pan locus tag?: SAUPAN003360000
- symbol: SAOUHSC_01082
- pan gene symbol?: isdC
- synonym:
- product: hypothetical protein
⊟Additional information (user-provided)[edit | edit source]
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: SAOUHSC_01082
- symbol: SAOUHSC_01082
- product: hypothetical protein
- replicon: chromosome
- strand: +
- coordinates: 1045629..1046312
- length: 684
- essential: no DEG other strains
⊟Accession numbers[edit | edit source]
- Gene ID: 3919244 NCBI
- RefSeq: YP_499628 NCBI
- BioCyc: G1I0R-1017 BioCyc
- MicrobesOnline: 1289541 MicrobesOnline
⊟Phenotype[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301
361
421
481
541
601
661TTGAAAAATATTTTAAAAGTTTTTAATACAACGATTTTAGCGTTAATTATCATCATCGCG
ACATTCAGTAATTCTGCAAATGCCGCAGATAGCGGTACTTTGAATTATGAGGTTTACAAA
TACAATACCAATGACACGTCAATTGCTAATGACTATTTTAATAAACCGGCAAAGTACATT
AAGAAAAATGGTAAATTGTATGTTCAAATAACTGTCAACCACAGTCATTGGATTACTGGA
ATGAGTATCGAAGGACATAAAGAAAATATTATTAGTAAAAACACTGCCAAAGATGAACGC
ACTTCTGAATTTGAAGTAAGTAAGTTGAACGGTAAAATAGATGGAAAAATTGACGTTTAT
ATCGATGAAAAAGTAAATGGAAAGCCATTCAAATATGACCATCATTACAACATTACATAT
AAATTTAATGGACCAACTGATGTAGCAGGTGCTAATGCACCAGGTAAAGATGATAAAAAT
TCTGCTTCAGGTAGTGACAAAGGATCTGATGGAACGACTACTGGTCAAAGTGAATCTAAT
AGTTCGAATAAAGACAAAGTAGAAAATCCACAAACAAATGCTGGTACACCTGCATATATA
TATGCAATACCAGTTGCATCCTTAGCATTATTAATCGCAATCACATTGTTTGTTAGAAAA
AAATCTAAAGGCAATGTGGAATAA60
120
180
240
300
360
420
480
540
600
660
684
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: SAOUHSC_01082
- symbol: SAOUHSC_01082
- description: hypothetical protein
- length: 227
- theoretical pI: 9.42324
- theoretical MW: 24854.6
- GRAVY: -0.564317
⊟Function[edit | edit source]
- TIGRFAM: heme uptake protein IsdC (TIGR03656; HMM-score: 320.3)and 2 moresortase B signal domain, NPQTN class (TIGR03068; HMM-score: 87.3)heme uptake protein IsdB (TIGR03657; HMM-score: 14.1)
- TheSEED :
- NPQTN cell wall anchored protein IsdC
- PFAM: E-set (CL0159) NEAT; Iron Transport-associated domain (PF05031; HMM-score: 102.5)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: unknown (no significant prediction)
- Cytoplasmic Score: 0
- Cytoplasmic Membrane Score: 3.33
- Cellwall Score: 3.33
- Extracellular Score: 3.33
- Internal Helices: 2
- DeepLocPro: Cytoplasmic Membrane
- Cytoplasmic Score: 0.0001
- Cytoplasmic Membrane Score: 0.5454
- Cell wall & surface Score: 0.215
- Extracellular Score: 0.2396
- LocateP: LPxTG Cell-wall anchored
- Prediction by SwissProt Classification: Cell Wall
- Pathway Prediction: Sec-(SPI)
- Intracellular possibility: 0
- Signal peptide possibility: 1
- N-terminally Anchored Score: -2
- Predicted Cleavage Site: found LPxTG motif :NPQTN
- SignalP: Signal peptide SP(Sec/SPI) length 28 aa
- SP(Sec/SPI): 0.998468
- TAT(Tat/SPI): 0.000645
- LIPO(Sec/SPII): 0.000521
- Cleavage Site: CS pos: 28-29. ANA-AD. Pr: 0.9892
- predicted transmembrane helices (TMHMM): 2
⊟Accession numbers[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Protein sequence[edit | edit source]
- MKNILKVFNTTILALIIIIATFSNSANAADSGTLNYEVYKYNTNDTSIANDYFNKPAKYIKKNGKLYVQITVNHSHWITGMSIEGHKENIISKNTAKDERTSEFEVSKLNGKIDGKIDVYIDEKVNGKPFKYDHHYNITYKFNGPTDVAGANAPGKDDKNSASGSDKGSDGTTTGQSESNSSNKDKVENPQTNAGTPAYIYAIPVASLALLIAITLFVRKKSKGNVE
⊟Experimental data[edit | edit source]
- experimentally validated: PeptideAtlas [1] [2]
- protein localization: data available for COL
- quantitative data / protein copy number per cell:
- interaction partners:
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
- predicted SigA promoter [3] : SAOUHSC_01082 > SAOUHSC_01084 > SAOUHSC_01085 > SAOUHSC_01086 > SAOUHSC_01087 > S447 > SAOUHSC_01088 > SAOUHSC_01089 > SAOUHSC_01090 > S448 > S449 > SAOUHSC_01091 > S450 > S451 > pheS > pheT
⊟Regulation[edit | edit source]
- regulator: Fur* (repression) regulon
Fur* (TF) important in Iron homeostasis; RegPrecise
⊟Additional information (user-provided)[edit | edit source]
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: [3]
Multi-gene expression profiles
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
- Aureolib: no data available
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Other information (user-provided)[edit | edit source]
You can add further information about the gene and protein here. [edit]
⊟Literature[edit | edit source]
⊟References[edit | edit source]
- ↑ Maren Depke, Stephan Michalik, Alexander Rabe, Kristin Surmann, Lars Brinkmann, Nico Jehmlich, Jörg Bernhardt, Michael Hecker, Bernd Wollscheid, Zhi Sun, Robert L Moritz, Uwe Völker, Frank Schmidt
A peptide resource for the analysis of Staphylococcus aureus in host-pathogen interaction studies.
Proteomics: 2015, 15(21);3648-61
[PubMed:26224020] [WorldCat.org] [DOI] (I p) - ↑ Stephan Michalik, Maren Depke, Annette Murr, Manuela Gesell Salazar, Ulrike Kusebauch, Zhi Sun, Tanja C Meyer, Kristin Surmann, Henrike Pförtner, Petra Hildebrandt, Stefan Weiss, Laura Marcela Palma Medina, Melanie Gutjahr, Elke Hammer, Dörte Becher, Thomas Pribyl, Sven Hammerschmidt, Eric W Deutsch, Samuel L Bader, Michael Hecker, Robert L Moritz, Ulrike Mäder, Uwe Völker, Frank Schmidt
A global Staphylococcus aureus proteome resource applied to the in vivo characterization of host-pathogen interactions.
Sci Rep: 2017, 7(1);9718
[PubMed:28887440] [WorldCat.org] [DOI] (I e) - ↑ 3.0 3.1 Ulrike Mäder, Pierre Nicolas, Maren Depke, Jan Pané-Farré, Michel Debarbouille, Magdalena M van der Kooi-Pol, Cyprien Guérin, Sandra Dérozier, Aurelia Hiron, Hanne Jarmer, Aurélie Leduc, Stephan Michalik, Ewoud Reilman, Marc Schaffer, Frank Schmidt, Philippe Bessières, Philippe Noirot, Michael Hecker, Tarek Msadek, Uwe Völker, Jan Maarten van Dijl
Staphylococcus aureus Transcriptome Architecture: From Laboratory to Infection-Mimicking Conditions.
PLoS Genet: 2016, 12(4);e1005962
[PubMed:27035918] [WorldCat.org] [DOI] (I e) - ↑ Michelle L Reniere, Eric P Skaar
Staphylococcus aureus haem oxygenases are differentially regulated by iron and haem.
Mol Microbiol: 2008, 69(5);1304-15
[PubMed:18643935] [WorldCat.org] [DOI] (I p)
⊟Relevant publications[edit | edit source]
Sarkis K Mazmanian, Hung Ton-That, Kenneth Su, Olaf Schneewind
An iron-regulated sortase anchors a class of surface protein during Staphylococcus aureus pathogenesis.
Proc Natl Acad Sci U S A: 2002, 99(4);2293-8
[PubMed:11830639] [WorldCat.org] [DOI] (P p)John M Taylor, David E Heinrichs
Transferrin binding in Staphylococcus aureus: involvement of a cell wall-anchored protein.
Mol Microbiol: 2002, 43(6);1603-14
[PubMed:11952908] [WorldCat.org] [DOI] (P p)John Mack, Christie Vermeiren, David E Heinrichs, Martin J Stillman
In vivo heme scavenging by Staphylococcus aureus IsdC and IsdE proteins.
Biochem Biophys Res Commun: 2004, 320(3);781-8
[PubMed:15240116] [WorldCat.org] [DOI] (P p)Luciano A Marraffini, Olaf Schneewind
Anchor structure of staphylococcal surface proteins. V. Anchor structure of the sortase B substrate IsdC.
J Biol Chem: 2005, 280(16);16263-71
[PubMed:15718231] [WorldCat.org] [DOI] (P p)Katherine H Sharp, Sabine Schneider, Alan Cockayne, Max Paoli
Crystal structure of the heme-IsdC complex, the central conduit of the Isd iron/heme uptake system in Staphylococcus aureus.
J Biol Chem: 2007, 282(14);10625-31
[PubMed:17287214] [WorldCat.org] [DOI] (P p)Mark Pluym, Naomi Muryoi, David E Heinrichs, Martin J Stillman
Heme binding in the NEAT domains of IsdA and IsdC of Staphylococcus aureus.
J Inorg Biochem: 2008, 102(3);480-8
[PubMed:18194816] [WorldCat.org] [DOI] (P p)
