From AureoWiki
Jump to navigation Jump to search

NCBI: 03-AUG-2016

Summary[edit | edit source]

  • organism: Staphylococcus aureus NCTC8325
  • locus tag: SAOUHSC_01105
  • pan locus tag?: SAUPAN003389000
  • symbol: sdhB
  • pan gene symbol?: sdhB
  • synonym:
  • product: succinate dehydrogenase iron-sulfur subunit

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SAOUHSC_01105
  • symbol: sdhB
  • product: succinate dehydrogenase iron-sulfur subunit
  • replicon: chromosome
  • strand: +
  • coordinates: 1067102..1067917
  • length: 816
  • essential: no DEG other strains

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    ATGACTGAACAATCAGTGAAAAACACTCCACAACATGAAACACAATCTAAACCGAAACAA
    AAAACAGTAAAATTAATTATTAAACGACAAGATACAAGTGATTCTAAGCCTTATGAAGAA
    ACATTTGAAATTCCATATCGTGAAAATTTAAACGTCATTGCTTGTTTAATGGAAATTAGA
    CGTAACCCAGTTAATATTAAAGGTGAAAAAACAACACCTGTTGTCTGGGATATGAACTGC
    TTAGAAGAAGTATGTGGAGCATGTTCTATGGTTATCAATGGTCGTGCAAGACAATCTTGT
    TCTGCGATTGTTGATCAATTAGAACAACCTATTCGTTTAGAGCCAATGAATACTTTCCCA
    GTTATCCGTGACTTACAAGTTGATCGTTCTAGAATGTTCGATAACTTAAAACGTATGAAA
    GCATGGATCCCAATTGATGGAACGTATGATTTAGGTCCGGGACCACGTATGCCAGAGAAA
    AAACGTCAAACAGCTTATGAATTATCTAAATGTATGACATGTGGTGTATGTTTAGAGGTT
    TGTCCTAATGTTACTGAAAATAATAAATTCGTTGGTGCACAAGCAATCTCGCAAGTTCGT
    TTGTTTAATTTGCACCCAACAGGATCTATGACTAAAGATGAACGTTTAAATGCATTAATG
    GGTACTGGTGGCTTACAGCAGTGTGGTAATTCACAAAACTGTGTTAATGCTTGCCCTAAA
    GGTATTCCATTAACAACATCCATTGCAGCAATGAACAGAGAAACAACATTCCACATGTTT
    AAATCATTCTTTGGTTCAGACCATGAAGTAGAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    816

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SAOUHSC_01105
  • symbol: SdhB
  • description: succinate dehydrogenase iron-sulfur subunit
  • length: 271
  • theoretical pI: 7.99685
  • theoretical MW: 30583.1
  • GRAVY: -0.501845

Function[edit | edit source]

  • reaction:
    EC 1.3.99.1?  ExPASy
    Deleted entry
  • TIGRFAM:
    Metabolism Energy metabolism TCA cycle succinate dehydrogenase and fumarate reductase iron-sulfur protein (TIGR00384; HMM-score: 137.1)
    Metabolism Energy metabolism Anaerobic succinate dehydrogenase and fumarate reductase iron-sulfur protein (TIGR00384; HMM-score: 137.1)
    Metabolism Energy metabolism Aerobic succinate dehydrogenase and fumarate reductase iron-sulfur protein (TIGR00384; HMM-score: 137.1)
    and 25 more
    Metabolism Energy metabolism Electron transport NADH-quinone oxidoreductase, chain I (TIGR01971; HMM-score: 19)
    Unknown function General archaeoflavoprotein, MJ0208 family (TIGR02700; HMM-score: 18.7)
    cytochrome c oxidase accessory protein CcoG (TIGR02745; HMM-score: 18)
    CoB--CoM heterodisulfide reductase, subunit C (TIGR03290; EC 1.8.98.1; HMM-score: 15.4)
    4-hydroxybenzoyl-CoA reductase, gamma subunit (TIGR03193; EC 1.3.7.9; HMM-score: 15.1)
    Metabolism Purines, pyrimidines, nucleosides, and nucleotides Other selenium-dependent xanthine dehydrogenase (TIGR03311; EC 1.17.1.4; HMM-score: 15.1)
    pyruvate:ferredoxin (flavodoxin) oxidoreductase (TIGR02176; EC 1.2.7.1; HMM-score: 14.1)
    Metabolism Energy metabolism Amino acids and amines choline TMA-lyase-activating enzyme (TIGR04395; EC 1.97.-.-; HMM-score: 13.8)
    Metabolism Energy metabolism Anaerobic glycerol-3-phosphate dehydrogenase, anaerobic, C subunit (TIGR03379; EC 1.1.5.3; HMM-score: 13.5)
    2-oxoacid:acceptor oxidoreductase, delta subunit, pyruvate/2-ketoisovalerate family (TIGR02179; HMM-score: 13.2)
    Metabolism Energy metabolism Electron transport NADH-plastoquinone oxidoreductase, I subunit (TIGR00403; EC 1.6.5.3; HMM-score: 13.1)
    Metabolism Energy metabolism Electron transport iron-sulfur cluster-binding protein (TIGR00273; HMM-score: 12)
    Metabolism Energy metabolism Methanogenesis putative methanogenesis marker 16 metalloprotein (TIGR03287; HMM-score: 11.9)
    Genetic information processing Protein synthesis tRNA and rRNA base modification epoxyqueuosine reductase (TIGR00276; EC 1.-.-.-; HMM-score: 11.8)
    Metabolism Energy metabolism Electron transport cytochrome c nitrite reductase, Fe-S protein (TIGR03149; EC 1.7.2.2; HMM-score: 11.5)
    Metabolism Energy metabolism Electron transport ferredoxin-type protein NapF (TIGR00402; HMM-score: 10.3)
    [FeFe] hydrogenase, group A (TIGR02512; EC 1.12.-.-; HMM-score: 9.9)
    Metabolism Energy metabolism Chemoautotrophy CO dehydrogenase/acetyl-CoA synthase complex, epsilon subunit (TIGR00314; EC 1.2.99.2; HMM-score: 9.4)
    methylamine methyltransferase corrinoid protein reductive activase (TIGR04270; HMM-score: 9.4)
    Metabolism Central intermediary metabolism Nitrogen fixation ferredoxin III, nif-specific (TIGR02936; HMM-score: 8.2)
    Metabolism Energy metabolism Electron transport electron transport complex, RnfABCDGE type, C subunit (TIGR01945; HMM-score: 7.7)
    glycyl-radical enzyme activating protein (TIGR02494; EC 1.97.1.-; HMM-score: 6.8)
    Genetic information processing Protein fate Protein modification and repair glycine radical enzyme activase, YjjW family (TIGR04041; EC 1.97.1.-; HMM-score: 6.6)
    ferredoxin-type protein, NapH/MauN family (TIGR02163; HMM-score: 6.5)
    Metabolism Central intermediary metabolism Sulfur metabolism sulfite reductase, dissimilatory-type beta subunit (TIGR02066; EC 1.8.99.3; HMM-score: 5.3)
  • TheSEED:  
    Carbohydrates Central carbohydrate metabolism acinetobacter tca  Succinate dehydrogenase iron-sulfur protein (EC 1.3.99.1)
    and 3 more
    TCA Cycle  Succinate dehydrogenase iron-sulfur protein (EC 1.3.99.1)
    One-carbon Metabolism Serine-glyoxylate cycle  Succinate dehydrogenase iron-sulfur protein (EC 1.3.99.1)
    Respiration Electron donating reactions Succinate dehydrogenase  Succinate dehydrogenase iron-sulfur protein (EC 1.3.99.1)
  • PFAM:
    Fer2 (CL0486) Fer2_3; 2Fe-2S iron-sulfur cluster binding domain (PF13085; HMM-score: 97.9)
    and 15 more
    4Fe-4S (CL0344) Fer4_8; 4Fe-4S dicluster domain (PF13183; HMM-score: 35.6)
    Fer4_7; 4Fe-4S dicluster domain (PF12838; HMM-score: 33.9)
    Fer4_9; 4Fe-4S dicluster domain (PF13187; HMM-score: 30.5)
    Fer4_10; 4Fe-4S dicluster domain (PF13237; HMM-score: 28.2)
    Fer4_17; 4Fe-4S dicluster domain (PF13534; HMM-score: 25.6)
    Fer4_16; 4Fe-4S double cluster binding domain (PF13484; HMM-score: 19.5)
    Fer4_2; 4Fe-4S binding domain (PF12797; HMM-score: 19.3)
    Fer4; 4Fe-4S binding domain (PF00037; HMM-score: 17.8)
    Fer4_15; 4Fe-4S single cluster domain (PF13459; HMM-score: 17.2)
    Fer4_13; 4Fe-4S single cluster domain of Ferredoxin I (PF13370; HMM-score: 16.8)
    Fer4_21; 4Fe-4S dicluster domain (PF14697; HMM-score: 14.7)
    Fer4_6; 4Fe-4S binding domain (PF12837; HMM-score: 13.8)
    Fer4_4; 4Fe-4S binding domain (PF12800; HMM-score: 12.9)
    Fer4_18; 4Fe-4S dicluster domain (PF13746; HMM-score: 11.5)
    Fer4_3; 4Fe-4S binding domain (PF12798; HMM-score: 9.8)

Structure, modifications & interactions[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.89
    • Cytoplasmic Membrane Score: 0.09
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 1
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.004685
    • TAT(Tat/SPI): 0.00098
    • LIPO(Sec/SPII): 0.000969
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

Protein sequence[edit | edit source]

  • MTEQSVKNTPQHETQSKPKQKTVKLIIKRQDTSDSKPYEETFEIPYRENLNVIACLMEIRRNPVNIKGEKTTPVVWDMNCLEEVCGACSMVINGRARQSCSAIVDQLEQPIRLEPMNTFPVIRDLQVDRSRMFDNLKRMKAWIPIDGTYDLGPGPRMPEKKRQTAYELSKCMTCGVCLEVCPNVTENNKFVGAQAISQVRLFNLHPTGSMTKDERLNALMGTGGLQQCGNSQNCVNACPKGIPLTTSIAAMNRETTFHMFKSFFGSDHEVE

Experimental data[edit | edit source]

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator: CcpA* regulon
    CcpA(TF)important in Carbon catabolism; RegPrecise    transcription unit transferred from N315 data RegPrecise  

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

  1. Maren Depke, Stephan Michalik, Alexander Rabe, Kristin Surmann, Lars Brinkmann, Nico Jehmlich, Jörg Bernhardt, Michael Hecker, Bernd Wollscheid, Zhi Sun, Robert L Moritz, Uwe Völker, Frank Schmidt
    A peptide resource for the analysis of Staphylococcus aureus in host-pathogen interaction studies.
    Proteomics: 2015, 15(21);3648-61
    [PubMed:26224020] [WorldCat.org] [DOI] (I p)
  2. Stephan Michalik, Maren Depke, Annette Murr, Manuela Gesell Salazar, Ulrike Kusebauch, Zhi Sun, Tanja C Meyer, Kristin Surmann, Henrike Pförtner, Petra Hildebrandt, Stefan Weiss, Laura Marcela Palma Medina, Melanie Gutjahr, Elke Hammer, Dörte Becher, Thomas Pribyl, Sven Hammerschmidt, Eric W Deutsch, Samuel L Bader, Michael Hecker, Robert L Moritz, Ulrike Mäder, Uwe Völker, Frank Schmidt
    A global Staphylococcus aureus proteome resource applied to the in vivo characterization of host-pathogen interactions.
    Sci Rep: 2017, 7(1);9718
    [PubMed:28887440] [WorldCat.org] [DOI] (I e)
  3. Ulrike Mäder, Pierre Nicolas, Maren Depke, Jan Pané-Farré, Michel Debarbouille, Magdalena M van der Kooi-Pol, Cyprien Guérin, Sandra Dérozier, Aurelia Hiron, Hanne Jarmer, Aurélie Leduc, Stephan Michalik, Ewoud Reilman, Marc Schaffer, Frank Schmidt, Philippe Bessières, Philippe Noirot, Michael Hecker, Tarek Msadek, Uwe Völker, Jan Maarten van Dijl
    Staphylococcus aureus Transcriptome Architecture: From Laboratory to Infection-Mimicking Conditions.
    PLoS Genet: 2016, 12(4);e1005962
    [PubMed:27035918] [WorldCat.org] [DOI] (I e)

Relevant publications[edit | edit source]

Rosmarie Gaupp, Steffen Schlag, Manuel Liebeke, Michael Lalk, Friedrich Götz
Advantage of upregulation of succinate dehydrogenase in Staphylococcus aureus biofilms.
J Bacteriol: 2010, 192(9);2385-94
[PubMed:20207757] [WorldCat.org] [DOI] (I p)