From AureoWiki
Jump to navigation Jump to search

NCBI: 03-AUG-2016

Summary[edit | edit source]

  • organism: Staphylococcus aureus NCTC8325
  • locus tag: SAOUHSC_01262
  • pan locus tag?: SAUPAN003587000
  • symbol: recA
  • pan gene symbol?: recA
  • synonym:
  • product: recombinase A

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SAOUHSC_01262
  • symbol: recA
  • product: recombinase A
  • replicon: chromosome
  • strand: +
  • coordinates: 1216223..1217266
  • length: 1044
  • essential: no DEG other strains

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    TTGGATAACGATCGTCAAAAAGCTTTAGATACAGTAATTAAAAATATGGAGAAATCTTTC
    GGTAAAGGTGCCGTAATGAAGTTGGGTGACAATATAGGTCGCCGAGTTTCAACTACATCA
    ACTGGTTCAGTTACATTAGATAATGCGCTAGGTGTAGGTGGCTATCCTAAAGGACGAATT
    ATTGAAATTTATGGTCCTGAAAGTTCTGGTAAGACAACAGTAGCGCTTCACGCTATTGCT
    GAAGTACAAAGTAATGGCGGGGTGGCAGCATTTATCGATGCTGAACATGCTTTAGATCCA
    GAATATGCTCAAGCATTAGGCGTAGATATCGATAATTTATATTTATCGCAACCGGATCAT
    GGTGAACAAGGTCTTGAAATCGCCGAAGCATTTGTTAGAAGTGGTGCAGTTGATATTGTA
    GTTGTAGACTCAGTTGCTGCTTTAACACCTAAAGCTGAAATTGAAGGAGAAATGGGAGAC
    ACTCACGTTGGTTTACAAGCTCGTTTAATGTCACAAGCGTTACGTAAACTTTCAGGTGCT
    ATTTCTAAATCAAATACAACTGCTATTTTCATCAACCAAATTCGTGAAAAAGTTGGTGTT
    ATGTTCGGTAATCCAGAGACTACACCAGGTGGACGTGCATTAAAATTCTATAGTTCAGTA
    AGACTAGAAGTACGTCGTGCAGAACAGCTTAAACAAGGACAAGAAATTGTAGGTAATAGA
    ACTAAAATTAAAGTCGTTAAAAATAAAGTGGCACCACCATTTAGAGTAGCTGAAGTTGAT
    ATTATGTATGGACAAGGTATTTCTAAAGAGGGTGAACTTATTGATTTAGGTGTTGAAAAC
    GACATCGTTGATAAATCAGGAGCATGGTATTCTTACAATGGCGAACGAATGGGTCAAGGT
    AAGGAAAATGTTAAAATGTACTTGAAAGAAAATCCACAAATTAAAGAAGAAATTGATCGT
    AAATTGAGAGAAAAATTAGGTATATCTGATGGTGATGTTGAAGAAACAGAAGATGCACCA
    AAGTCATTATTTGACGAAGAATAG
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1044

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SAOUHSC_01262
  • symbol: RecA
  • description: recombinase A
  • length: 347
  • theoretical pI: 4.85109
  • theoretical MW: 37656.3
  • GRAVY: -0.398847

Function[edit | edit source]

  • TIGRFAM:
    Genetic information processing DNA metabolism DNA replication, recombination, and repair protein RecA (TIGR02012; HMM-score: 565.3)
    and 11 more
    DNA repair and recombination protein RadB (TIGR02237; HMM-score: 60.3)
    Genetic information processing DNA metabolism DNA replication, recombination, and repair DNA repair and recombination protein RadA (TIGR02236; HMM-score: 41.2)
    meiotic recombinase Dmc1 (TIGR02238; HMM-score: 36.9)
    DNA repair protein RAD51 (TIGR02239; HMM-score: 31.4)
    KaiC domain protein, PAE1156 family (TIGR03881; HMM-score: 20.6)
    Genetic information processing DNA metabolism DNA replication, recombination, and repair DNA repair protein RadA (TIGR00416; HMM-score: 16.5)
    KaiC domain protein, AF_0351 family (TIGR03880; HMM-score: 16.2)
    2-aminoethylphosphonate ABC transport system, ATP-binding component PhnT (TIGR03258; HMM-score: 14)
    Metabolism Transport and binding proteins Unknown substrate energy-coupling factor transporter ATPase (TIGR04520; EC 3.6.3.-; HMM-score: 12.8)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Pantothenate and coenzyme A phosphopantothenoylcysteine decarboxylase / phosphopantothenate--cysteine ligase (TIGR00521; EC 4.1.1.36,6.3.2.5; HMM-score: 11.4)
    putative cytidylate kinase (TIGR02173; EC 2.7.4.14; HMM-score: 10.5)
  • TheSEED:  
    Clustering-based subsystems Two related proteases CBSS-257314.1.peg.676  RecA protein
    and 5 more
    DNA Metabolism DNA repair DNA repair, bacterial  RecA protein
    DNA repair, bacterial RecFOR pathway  RecA protein
    DNA repair, bacterial UmuCD system  RecA protein
    DNA replication DNA-replication  RecA protein
    Miscellaneous Plant-Prokaryote comparative genomics Competence or DNA damage-inducible protein CinA and related protein families  RecA protein
  • PFAM:
    P-loop_NTPase (CL0023) RecA; recA bacterial DNA recombination protein (PF00154; HMM-score: 473.1)
    and 10 more
    Rad51; Rad51 (PF08423; HMM-score: 44.4)
    ATPase; KaiC (PF06745; HMM-score: 36.4)
    ATPase_2; ATPase domain predominantly from Archaea (PF01637; HMM-score: 20.3)
    AAA_24; AAA domain (PF13479; HMM-score: 16.3)
    AAA_25; AAA domain (PF13481; HMM-score: 16.2)
    AAA_16; AAA ATPase domain (PF13191; HMM-score: 15.7)
    AAA; ATPase family associated with various cellular activities (AAA) (PF00004; HMM-score: 13.4)
    H-int (CL0363) PT-HINT; Pretoxin HINT domain (PF07591; HMM-score: 13.2)
    P-loop_NTPase (CL0023) CobU; Cobinamide kinase / cobinamide phosphate guanyltransferase (PF02283; HMM-score: 13)
    NADP_Rossmann (CL0063) DFP; DNA / pantothenate metabolism flavoprotein (PF04127; HMM-score: 12.5)

Structure, modifications & interactions[edit | edit source]

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 1
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.048833
    • TAT(Tat/SPI): 0.065314
    • LIPO(Sec/SPII): 0.00261
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

Protein sequence[edit | edit source]

  • MDNDRQKALDTVIKNMEKSFGKGAVMKLGDNIGRRVSTTSTGSVTLDNALGVGGYPKGRIIEIYGPESSGKTTVALHAIAEVQSNGGVAAFIDAEHALDPEYAQALGVDIDNLYLSQPDHGEQGLEIAEAFVRSGAVDIVVVDSVAALTPKAEIEGEMGDTHVGLQARLMSQALRKLSGAISKSNTTAIFINQIREKVGVMFGNPETTPGGRALKFYSSVRLEVRRAEQLKQGQEIVGNRTKIKVVKNKVAPPFRVAEVDIMYGQGISKEGELIDLGVENDIVDKSGAWYSYNGERMGQGKENVKMYLKENPQIKEEIDRKLREKLGISDGDVEETEDAPKSLFDEE

Experimental data[edit | edit source]

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

  • recA no polycistronic organisation predicted

Regulation[edit | edit source]

  • regulator: LexA* (repression) regulon
    LexA(TF)important in SOS response; RegPrecise  

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

  1. 1.0 1.1 1.2 1.3 1.4 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J Proteome Res: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)
  2. Maren Depke, Stephan Michalik, Alexander Rabe, Kristin Surmann, Lars Brinkmann, Nico Jehmlich, Jörg Bernhardt, Michael Hecker, Bernd Wollscheid, Zhi Sun, Robert L Moritz, Uwe Völker, Frank Schmidt
    A peptide resource for the analysis of Staphylococcus aureus in host-pathogen interaction studies.
    Proteomics: 2015, 15(21);3648-61
    [PubMed:26224020] [WorldCat.org] [DOI] (I p)
  3. Stephan Michalik, Maren Depke, Annette Murr, Manuela Gesell Salazar, Ulrike Kusebauch, Zhi Sun, Tanja C Meyer, Kristin Surmann, Henrike Pförtner, Petra Hildebrandt, Stefan Weiss, Laura Marcela Palma Medina, Melanie Gutjahr, Elke Hammer, Dörte Becher, Thomas Pribyl, Sven Hammerschmidt, Eric W Deutsch, Samuel L Bader, Michael Hecker, Robert L Moritz, Ulrike Mäder, Uwe Völker, Frank Schmidt
    A global Staphylococcus aureus proteome resource applied to the in vivo characterization of host-pathogen interactions.
    Sci Rep: 2017, 7(1);9718
    [PubMed:28887440] [WorldCat.org] [DOI] (I e)
  4. Ulrike Mäder, Pierre Nicolas, Maren Depke, Jan Pané-Farré, Michel Debarbouille, Magdalena M van der Kooi-Pol, Cyprien Guérin, Sandra Dérozier, Aurelia Hiron, Hanne Jarmer, Aurélie Leduc, Stephan Michalik, Ewoud Reilman, Marc Schaffer, Frank Schmidt, Philippe Bessières, Philippe Noirot, Michael Hecker, Tarek Msadek, Uwe Völker, Jan Maarten van Dijl
    Staphylococcus aureus Transcriptome Architecture: From Laboratory to Infection-Mimicking Conditions.
    PLoS Genet: 2016, 12(4);e1005962
    [PubMed:27035918] [WorldCat.org] [DOI] (I e)

Relevant publications[edit | edit source]