From AureoWiki
Jump to navigation Jump to search

NCBI: 03-AUG-2016

Summary[edit | edit source]

  • organism: Staphylococcus aureus NCTC8325
  • locus tag: SAOUHSC_01499
  • pan locus tag?: SAUPAN003944000
  • symbol: SAOUHSC_01499
  • pan gene symbol?:
  • synonym:
  • product: hypothetical protein

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SAOUHSC_01499
  • symbol: SAOUHSC_01499
  • product: hypothetical protein
  • replicon: chromosome
  • strand: -
  • coordinates: 1452300..1453286
  • length: 987
  • essential: no DEG other strains

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    ATGCAAAAAGTTGAAAGTATCATAATTGGTGGAGGGCCATGCGGATTAAGTGCGGCTATT
    GAACAAAAAAGAAAAGGTATTGATACCTTAATTATTGAAAAGGGTAATGTCGTTGAATCA
    ATCTACAATTATCCTACTCACCAAACATTTTTCTCATCAAGTGATAAATTAAGTATTGGG
    GACGTACCGTTTATCGTTGAAGAAAGTAAACCAAGACGTAATCAAGCGCTAGTTTATTAC
    CGAGAAGTTGTAAAACATCATCAATTAAAAGTAAATGCATTTGAAGAAGTATTAACTGTT
    AAAAAAATGAATAATAAATTTACTATTACTACGACGAAAGATGTTTATGAATGTCGATTT
    TTAACAATCGCGACAGGCTATTATGGTCAGCATAATACATTAGAAGTTGAAGGTGCGGAT
    TTACCTAAAGTGTTCCATTATTTTAAAGAGGCACATCCGTATTTTGATCAAGATGTTGTA
    ATTATCGGTGGTAAGAATTCGGCTATCGATGCTGCTTTGGAGTTGGAAAAAGCTGGTGCT
    AACGTGACGGTTCTATATCGTGGTGGAGATTATTCGCCTTCAATTAAACCGTGGATACTT
    CCAAATTTCACAGCATTAGTAAATCATGAAAAAATTGACATGGAATTTAATGCTAATGTT
    ACCCAAATAACTGAAGATACTGTGACTTATGAAGTAAATGGTGAAAGTAAAACGATACAC
    AATGATTATGTATTTGCGATGATTGGTTATCATCCCGATTATGAATTTTTAAAATCTGTA
    GGCATTCAAATTAATACAAATGAATTTGGAACAGCGCCTATGTATAATAAAGAAACATAC
    GAAACAAATATCGAAAATTGCTATATTGCAGGTGTAATTGCTGCAGGGAACGATGCGAAT
    ACCATTTTTATTGAAAATGGTAAATTCCACGGGGGCATTATTGCTCAAAGCATGCTAGCT
    AAGAAACAAACGCCCTTAGAATCATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    987

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SAOUHSC_01499
  • symbol: SAOUHSC_01499
  • description: hypothetical protein
  • length: 328
  • theoretical pI: 5.39888
  • theoretical MW: 36736.3
  • GRAVY: -0.271646

Function[edit | edit source]

  • TIGRFAM:
    Unknown function Enzymes of unknown specificity putative bacillithiol system oxidoreductase, YpdA family (TIGR04018; EC 1.8.-.-; HMM-score: 457.2)
    and 42 more
    Metabolism Energy metabolism Electron transport thioredoxin-disulfide reductase (TIGR01292; EC 1.8.1.9; HMM-score: 87.3)
    Cellular processes Cellular processes Detoxification CoA-disulfide reductase (TIGR03385; EC 1.8.1.14; HMM-score: 61.7)
    dihydrolipoyl dehydrogenase (TIGR01350; EC 1.8.1.4; HMM-score: 59.3)
    Cellular processes Cellular processes Detoxification alkyl hydroperoxide reductase subunit F (TIGR03140; EC 1.8.1.-; HMM-score: 50.8)
    Cellular processes Cellular processes Adaptations to atypical conditions alkyl hydroperoxide reductase subunit F (TIGR03140; EC 1.8.1.-; HMM-score: 50.8)
    Cellular processes Cellular processes Detoxification mercury(II) reductase (TIGR02053; EC 1.16.1.1; HMM-score: 49.4)
    putative selenate reductase, YgfK subunit (TIGR03315; HMM-score: 48.8)
    putative alkyl hydroperoxide reductase F subunit (TIGR03143; EC 1.6.4.-; HMM-score: 48.2)
    Metabolism Amino acid biosynthesis Glutamate family glutamate synthase (NADPH), homotetrameric (TIGR01316; EC 1.4.1.13; HMM-score: 38.6)
    flavin-dependent oxidoreductase, MSMEG_0569 family (TIGR04046; HMM-score: 35.1)
    Unknown function Enzymes of unknown specificity flavoprotein, HI0933 family (TIGR00275; HMM-score: 34.1)
    Metabolism Energy metabolism Electron transport glutathione-disulfide reductase (TIGR01421; EC 1.8.1.7; HMM-score: 29.5)
    squalene-associated FAD-dependent desaturase (TIGR03467; HMM-score: 25.6)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Thiamine thiazole biosynthesis enzyme (TIGR00292; HMM-score: 25.5)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Chlorophyll and bacteriochlorphyll geranylgeranyl reductase family (TIGR02032; EC 1.3.1.-; HMM-score: 25.2)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Chlorophyll and bacteriochlorphyll geranylgeranyl reductase (TIGR02023; EC 1.3.1.-; HMM-score: 23.3)
    Metabolism Energy metabolism Other 4-hydroxybenzoate 3-monooxygenase (TIGR02360; EC 1.14.13.2; HMM-score: 20.8)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Heme, porphyrin, and cobalamin precorrin 3B synthase CobZ (TIGR02485; HMM-score: 20.3)
    pyridine nucleotide-disulfide oxidoreductase family protein (TIGR03169; HMM-score: 20.2)
    mycothione reductase (TIGR03452; EC 1.8.1.15; HMM-score: 19.2)
    glutamate synthase, small subunit (TIGR01318; HMM-score: 19)
    Metabolism Central intermediary metabolism Nitrogen metabolism nitrite reductase [NAD(P)H], large subunit (TIGR02374; EC 1.7.1.4; HMM-score: 18.4)
    glutamate synthase, NADH/NADPH, small subunit (TIGR01317; EC 1.4.1.-; HMM-score: 18.2)
    Metabolism Energy metabolism Anaerobic glycerol-3-phosphate dehydrogenase, anaerobic, B subunit (TIGR03378; EC 1.1.5.3; HMM-score: 18.1)
    Metabolism Energy metabolism Amino acids and amines sarcosine oxidase, alpha subunit family (TIGR01372; HMM-score: 17.1)
    Metabolism Energy metabolism Amino acids and amines sarcosine oxidase, monomeric form (TIGR01377; HMM-score: 16.8)
    mycofactocin system FadH/OYE family oxidoreductase 2 (TIGR03997; EC 1.-.-.-; HMM-score: 16.8)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Other phytoene desaturase (TIGR02734; EC 1.14.99.-; HMM-score: 16.7)
    Metabolism Energy metabolism TCA cycle succinate dehydrogenase or fumarate reductase, flavoprotein subunit (TIGR01812; HMM-score: 16.4)
    Metabolism Energy metabolism Anaerobic succinate dehydrogenase or fumarate reductase, flavoprotein subunit (TIGR01812; HMM-score: 16.4)
    Metabolism Energy metabolism Aerobic succinate dehydrogenase or fumarate reductase, flavoprotein subunit (TIGR01812; HMM-score: 16.4)
    thioredoxin and glutathione reductase (TIGR01438; EC 1.6.4.-; HMM-score: 16)
    lycopene cyclase family protein (TIGR01790; HMM-score: 15.8)
    Metabolism Energy metabolism TCA cycle succinate dehydrogenase, flavoprotein subunit (TIGR01816; HMM-score: 15)
    Metabolism Energy metabolism Electron transport flavocytochrome c (TIGR01813; HMM-score: 14.9)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Chlorophyll and bacteriochlorphyll geranylgeranyl reductase (TIGR02028; HMM-score: 12.8)
    FAD dependent oxidoreductase TIGR03364 (TIGR03364; HMM-score: 12.4)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Menaquinone and ubiquinone ubiquinone biosynthesis hydroxylase, UbiH/UbiF/VisC/COQ6 family (TIGR01988; EC 1.14.13.-; HMM-score: 12.2)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Menaquinone and ubiquinone 2-polyprenyl-6-methoxyphenol 4-hydroxylase (TIGR01984; EC 1.14.13.-; HMM-score: 11.2)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Pyridine nucleotides L-aspartate oxidase (TIGR00551; EC 1.4.3.16; HMM-score: 11.1)
    Genetic information processing Protein synthesis tRNA and rRNA base modification tRNA U-34 5-methylaminomethyl-2-thiouridine biosynthesis protein MnmC, C-terminal domain (TIGR03197; HMM-score: 9.4)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Thiamine glycine oxidase ThiO (TIGR02352; EC 1.4.3.19; HMM-score: 8)
  • TheSEED:  
    Nucleosides and Nucleotides Pyrimidines pyrimidine conversions  Thioredoxin reductase (EC 1.8.1.9)
    and 1 more
    Sulfur Metabolism Sulfur Metabolism - no subcategory Thioredoxin-disulfide reductase  Thioredoxin reductase (EC 1.8.1.9)
  • PFAM:
    NADP_Rossmann (CL0063) Pyr_redox_3; Pyridine nucleotide-disulphide oxidoreductase (PF13738; HMM-score: 328)
    and 14 more
    Pyr_redox_2; Pyridine nucleotide-disulphide oxidoreductase (PF07992; HMM-score: 92.7)
    Pyr_redox; Pyridine nucleotide-disulphide oxidoreductase (PF00070; HMM-score: 39.6)
    FAD_oxidored; FAD dependent oxidoreductase (PF12831; HMM-score: 38.6)
    FAD_binding_3; FAD binding domain (PF01494; HMM-score: 35.4)
    FAD_binding_2; FAD binding domain (PF00890; HMM-score: 34.1)
    HI0933_like; HI0933-like protein (PF03486; HMM-score: 30.7)
    Thi4; Thi4 family (PF01946; HMM-score: 28.2)
    GIDA; Glucose inhibited division protein A (PF01134; HMM-score: 25.9)
    NAD_binding_8; NAD(P)-binding Rossmann-like domain (PF13450; HMM-score: 24.8)
    Lycopene_cycl; Lycopene cyclase protein (PF05834; HMM-score: 17.3)
    FMO-like; Flavin-binding monooxygenase-like (PF00743; HMM-score: 16.9)
    DAO; FAD dependent oxidoreductase (PF01266; HMM-score: 16.7)
    NAD_binding_7; Putative NAD(P)-binding (PF13241; HMM-score: 16.2)
    ACT (CL0070) ALS_ss_C; Small subunit of acetolactate synthase (PF10369; HMM-score: 11.9)

Structure, modifications & interactions[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 1
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: -1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.014127
    • TAT(Tat/SPI): 0.000471
    • LIPO(Sec/SPII): 0.009747
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

Protein sequence[edit | edit source]

  • MQKVESIIIGGGPCGLSAAIEQKRKGIDTLIIEKGNVVESIYNYPTHQTFFSSSDKLSIGDVPFIVEESKPRRNQALVYYREVVKHHQLKVNAFEEVLTVKKMNNKFTITTTKDVYECRFLTIATGYYGQHNTLEVEGADLPKVFHYFKEAHPYFDQDVVIIGGKNSAIDAALELEKAGANVTVLYRGGDYSPSIKPWILPNFTALVNHEKIDMEFNANVTQITEDTVTYEVNGESKTIHNDYVFAMIGYHPDYEFLKSVGIQINTNEFGTAPMYNKETYETNIENCYIAGVIAAGNDANTIFIENGKFHGGIIAQSMLAKKQTPLES

Experimental data[edit | edit source]

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

  • SAOUHSC_01499 no polycistronic organisation predicted

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

  1. Maren Depke, Stephan Michalik, Alexander Rabe, Kristin Surmann, Lars Brinkmann, Nico Jehmlich, Jörg Bernhardt, Michael Hecker, Bernd Wollscheid, Zhi Sun, Robert L Moritz, Uwe Völker, Frank Schmidt
    A peptide resource for the analysis of Staphylococcus aureus in host-pathogen interaction studies.
    Proteomics: 2015, 15(21);3648-61
    [PubMed:26224020] [WorldCat.org] [DOI] (I p)
  2. Stephan Michalik, Maren Depke, Annette Murr, Manuela Gesell Salazar, Ulrike Kusebauch, Zhi Sun, Tanja C Meyer, Kristin Surmann, Henrike Pförtner, Petra Hildebrandt, Stefan Weiss, Laura Marcela Palma Medina, Melanie Gutjahr, Elke Hammer, Dörte Becher, Thomas Pribyl, Sven Hammerschmidt, Eric W Deutsch, Samuel L Bader, Michael Hecker, Robert L Moritz, Ulrike Mäder, Uwe Völker, Frank Schmidt
    A global Staphylococcus aureus proteome resource applied to the in vivo characterization of host-pathogen interactions.
    Sci Rep: 2017, 7(1);9718
    [PubMed:28887440] [WorldCat.org] [DOI] (I e)
  3. Ulrike Mäder, Pierre Nicolas, Maren Depke, Jan Pané-Farré, Michel Debarbouille, Magdalena M van der Kooi-Pol, Cyprien Guérin, Sandra Dérozier, Aurelia Hiron, Hanne Jarmer, Aurélie Leduc, Stephan Michalik, Ewoud Reilman, Marc Schaffer, Frank Schmidt, Philippe Bessières, Philippe Noirot, Michael Hecker, Tarek Msadek, Uwe Völker, Jan Maarten van Dijl
    Staphylococcus aureus Transcriptome Architecture: From Laboratory to Infection-Mimicking Conditions.
    PLoS Genet: 2016, 12(4);e1005962
    [PubMed:27035918] [WorldCat.org] [DOI] (I e)

Relevant publications[edit | edit source]