From AureoWiki
Jump to navigation Jump to search

NCBI: 03-AUG-2016

Summary[edit | edit source]

  • organism: Staphylococcus aureus NCTC8325
  • locus tag: SAOUHSC_01614
  • pan locus tag?: SAUPAN004073000
  • symbol: SAOUHSC_01614
  • pan gene symbol?: lpdA
  • synonym:
  • product: dihydrolipoamide dehydrogenase

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SAOUHSC_01614
  • symbol: SAOUHSC_01614
  • product: dihydrolipoamide dehydrogenase
  • replicon: chromosome
  • strand: -
  • coordinates: 1537915..1539336
  • length: 1422
  • essential: no DEG other strains

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    1381
    ATGTCAGAGAAACAATATGATTTAGTCGTTCTCGGTGGAGGTACTGCAGGATATGTTGCT
    GCGATACGTGCGTCTCAATTAGGTAAAAAAGTGGCAATAGTAGAACGACAACTATTAGGA
    GGTACTTGTCTCCATAAAGGTTGTATTCCTACTAAATCGCTGCTTAAATCTGCTGAAGTA
    TTTCAAACAGTAAAACAGGCAGCAATGTTTGGCGTTGATGTCAAAGATGCTAATGTTAAT
    TTTGAAAATATGTTGGCACGAAAAGAAGACATTATTAATCAAATGTATCAAGGTGTAAAG
    CATTTAATGCAACACAATCACATTGACATTTATAATGGCACGGGACGTATTCTAGGTACA
    TCTATATTTTCACCTCAAAGTGGCACAATTTCTGTCGAATATGAAGATGGTGAATCAGAC
    TTATTACCCAACCAATTTGTATTAATTGCAACTGGTTCTTCGCCTGCAGAGTTGCCATTC
    TTATCATTTGATCATGATAAAATTTTATCTAGCGATGATATATTATCATTAAAGACGTTA
    CCATCAAGTATTGGTATTATTGGTGGTGGTGTTATCGGAATGGAATTTGCATCATTGATG
    ATAGATTTAGGTGTTGACGTAACAGTTATAGAAGCAGGTGAAAGAATTTTACCAACTGAA
    AGTAAACAAGCTTCACAACTATTAAAAAAATCATTGTCAGCACGTGGTGTTAAATTCTAT
    GAGGGAATAAAACTTTCTGAAAATGATATAAATGTTAACGAAGATGGTGTTACGTTTGAA
    ATTTCCTCAGACATAATTAAAGTAGATAAAGTGTTGCTATCGATTGGTAGAAAACCTAAC
    ACATCAGATATTGGTTTAAACAACACTAAAATAAAACTTTCAACATCAGGACATATTTTA
    ACGAACGAATTTCAACAAACTGAAGATAAACATATTTATGCAGCTGGTGATTGTATAGGA
    AAATTACAATTGGCACATGTTGGATCAAAAGAAGGTGTTGTGGCTGTTGATCATATGTTT
    GAGGGGAACCCAATCCCAGTAAACTATAACATGATGCCTAAGTGTATTTATTCACAACCT
    GAAATTGCTTCTATCGGTTTAAACATTGAACAAGCAAAGGCAGAGGGAATGAAAGTTAAA
    AGTTTTAAAGTACCATTTAAAGCAATTGGTAAAGCAGTGATTGATAGCCATGACACAAAC
    GAAGGGTATAGCGAAATGGTGATTGATCAATCAACTGAAGAAATTGTGGGTATTAATATG
    ATTGGTCCACATGTAACAGAATTGATTAATGAGGCATCACTGTTACAGTTCATGAATGGC
    TCGGCATTAGAATTAGGACTAACAACACACGCACATCCTTCCATCTCTGAAGTGTTGATG
    GAATTAGGATTGAAAGCAGAAAGTAGAGCTATTCACGTATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380
    1422

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SAOUHSC_01614
  • symbol: SAOUHSC_01614
  • description: dihydrolipoamide dehydrogenase
  • length: 473
  • theoretical pI: 5.20012
  • theoretical MW: 51111.3
  • GRAVY: -0.015222

Function[edit | edit source]

  • reaction:
    EC 1.8.1.4?  ExPASy
    Dihydrolipoyl dehydrogenase Protein N6-(dihydrolipoyl)lysine + NAD+ = protein N6-(lipoyl)lysine + NADH
  • TIGRFAM:
    dihydrolipoyl dehydrogenase (TIGR01350; EC 1.8.1.4; HMM-score: 501.1)
    and 44 more
    Cellular processes Cellular processes Detoxification mercury(II) reductase (TIGR02053; EC 1.16.1.1; HMM-score: 313.4)
    Metabolism Energy metabolism Electron transport glutathione-disulfide reductase (TIGR01424; EC 1.8.1.7; HMM-score: 259.8)
    Metabolism Energy metabolism Electron transport glutathione-disulfide reductase (TIGR01421; EC 1.8.1.7; HMM-score: 236.3)
    mycothione reductase (TIGR03452; EC 1.8.1.15; HMM-score: 200.1)
    thioredoxin and glutathione reductase (TIGR01438; EC 1.6.4.-; HMM-score: 178.6)
    trypanothione-disulfide reductase (TIGR01423; EC 1.8.1.12; HMM-score: 154.2)
    Cellular processes Cellular processes Detoxification CoA-disulfide reductase (TIGR03385; EC 1.8.1.14; HMM-score: 72.8)
    Metabolism Central intermediary metabolism Nitrogen metabolism nitrite reductase [NAD(P)H], large subunit (TIGR02374; EC 1.7.1.4; HMM-score: 65.5)
    Metabolism Energy metabolism Electron transport thioredoxin-disulfide reductase (TIGR01292; EC 1.8.1.9; HMM-score: 50.8)
    pyridine nucleotide-disulfide oxidoreductase family protein (TIGR03169; HMM-score: 50.7)
    Cellular processes Cellular processes Detoxification alkyl hydroperoxide reductase subunit F (TIGR03140; EC 1.8.1.-; HMM-score: 37.9)
    Cellular processes Cellular processes Adaptations to atypical conditions alkyl hydroperoxide reductase subunit F (TIGR03140; EC 1.8.1.-; HMM-score: 37.9)
    mycofactocin system FadH/OYE family oxidoreductase 2 (TIGR03997; EC 1.-.-.-; HMM-score: 34)
    putative alkyl hydroperoxide reductase F subunit (TIGR03143; EC 1.6.4.-; HMM-score: 33.9)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Chlorophyll and bacteriochlorphyll geranylgeranyl reductase family (TIGR02032; EC 1.3.1.-; HMM-score: 30.6)
    Metabolism Amino acid biosynthesis Glutamate family glutamate synthase (NADPH), homotetrameric (TIGR01316; EC 1.4.1.13; HMM-score: 30.2)
    Metabolism Energy metabolism Anaerobic glycerol-3-phosphate dehydrogenase, anaerobic, B subunit (TIGR03378; EC 1.1.5.3; HMM-score: 27.7)
    Unknown function Enzymes of unknown specificity flavoprotein, HI0933 family (TIGR00275; HMM-score: 25.5)
    Metabolism Energy metabolism Amino acids and amines alanine dehydrogenase (TIGR00518; EC 1.4.1.1; HMM-score: 25)
    glutamate synthase, small subunit (TIGR01318; HMM-score: 25)
    glutamate synthase, NADH/NADPH, small subunit (TIGR01317; EC 1.4.1.-; HMM-score: 23.7)
    Cell structure Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides UDP-galactopyranose mutase (TIGR00031; EC 5.4.99.9; HMM-score: 22.5)
    Metabolism Energy metabolism Amino acids and amines sarcosine oxidase, alpha subunit family (TIGR01372; HMM-score: 20.2)
    FAD dependent oxidoreductase TIGR03364 (TIGR03364; HMM-score: 19.1)
    mycofactocin system FadH/OYE family oxidoreductase 1 (TIGR03996; EC 1.-.-.-; HMM-score: 19)
    Unknown function Enzymes of unknown specificity putative bacillithiol system oxidoreductase, YpdA family (TIGR04018; EC 1.8.-.-; HMM-score: 18.4)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Menaquinone and ubiquinone 2-polyprenyl-6-methoxyphenol 4-hydroxylase (TIGR01984; EC 1.14.13.-; HMM-score: 17.3)
    squalene-associated FAD-dependent desaturase (TIGR03467; HMM-score: 17.1)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Thiamine glycine oxidase ThiO (TIGR02352; EC 1.4.3.19; HMM-score: 16.8)
    Metabolism Energy metabolism TCA cycle succinate dehydrogenase, flavoprotein subunit (TIGR01816; HMM-score: 15.5)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Menaquinone and ubiquinone ubiquinone biosynthesis hydroxylase, UbiH/UbiF/VisC/COQ6 family (TIGR01988; EC 1.14.13.-; HMM-score: 15.2)
    Metabolism Energy metabolism Electron transport flavocytochrome c (TIGR01813; HMM-score: 14.6)
    Genetic information processing Protein synthesis tRNA and rRNA base modification tRNA U-34 5-methylaminomethyl-2-thiouridine biosynthesis protein MnmC, C-terminal domain (TIGR03197; HMM-score: 14.2)
    nucleotide sugar dehydrogenase (TIGR03026; HMM-score: 13.1)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Chlorophyll and bacteriochlorphyll geranylgeranyl reductase (TIGR02023; EC 1.3.1.-; HMM-score: 12.9)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Other C-3',4' desaturase CrtD (TIGR02733; EC 1.3.99.-; HMM-score: 12.7)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Heme, porphyrin, and cobalamin precorrin 3B synthase CobZ (TIGR02485; HMM-score: 11.8)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Thiamine thiazole biosynthesis enzyme (TIGR00292; HMM-score: 11.2)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Pyridine nucleotides L-aspartate oxidase (TIGR00551; EC 1.4.3.16; HMM-score: 10.7)
    Metabolism Energy metabolism TCA cycle succinate dehydrogenase or fumarate reductase, flavoprotein subunit (TIGR01812; HMM-score: 10)
    Metabolism Energy metabolism Anaerobic succinate dehydrogenase or fumarate reductase, flavoprotein subunit (TIGR01812; HMM-score: 10)
    Metabolism Energy metabolism Aerobic succinate dehydrogenase or fumarate reductase, flavoprotein subunit (TIGR01812; HMM-score: 10)
    lycopene cyclase family protein (TIGR01790; HMM-score: 8)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Other phytoene desaturase (TIGR02734; EC 1.14.99.-; HMM-score: 6.7)
  • TheSEED:  
    Amino Acids and Derivatives Branched-chain amino acids Isoleucine degradation  Dihydrolipoamide dehydrogenase of branched-chain alpha-keto acid dehydrogenase (EC 1.8.1.4)
    and 2 more
    Valine degradation  Dihydrolipoamide dehydrogenase of branched-chain alpha-keto acid dehydrogenase (EC 1.8.1.4)
    Carbohydrates Central carbohydrate metabolism Dehydrogenase complexes  Dihydrolipoamide dehydrogenase of branched-chain alpha-keto acid dehydrogenase (EC 1.8.1.4)
  • PFAM:
    NADP_Rossmann (CL0063) Pyr_redox_2; Pyridine nucleotide-disulphide oxidoreductase (PF07992; HMM-score: 200.5)
    and 18 more
    Reductase_C (CL0608) Pyr_redox_dim; Pyridine nucleotide-disulphide oxidoreductase, dimerisation domain (PF02852; HMM-score: 101.2)
    NADP_Rossmann (CL0063) Pyr_redox; Pyridine nucleotide-disulphide oxidoreductase (PF00070; HMM-score: 70.2)
    FAD_oxidored; FAD dependent oxidoreductase (PF12831; HMM-score: 35.1)
    GIDA; Glucose inhibited division protein A (PF01134; HMM-score: 33.9)
    NAD_binding_8; NAD(P)-binding Rossmann-like domain (PF13450; HMM-score: 33)
    Pyr_redox_3; Pyridine nucleotide-disulphide oxidoreductase (PF13738; HMM-score: 32.7)
    AlaDh_PNT_C; Alanine dehydrogenase/PNT, C-terminal domain (PF01262; HMM-score: 31.7)
    DAO; FAD dependent oxidoreductase (PF01266; HMM-score: 28.3)
    HI0933_like; HI0933-like protein (PF03486; HMM-score: 25)
    FAD_binding_2; FAD binding domain (PF00890; HMM-score: 24.6)
    3HCDH_N; 3-hydroxyacyl-CoA dehydrogenase, NAD binding domain (PF02737; HMM-score: 24.3)
    FAD_binding_3; FAD binding domain (PF01494; HMM-score: 19.4)
    Trp_halogenase; Tryptophan halogenase (PF04820; HMM-score: 17.6)
    2-Hacid_dh_C; D-isomer specific 2-hydroxyacid dehydrogenase, NAD binding domain (PF02826; HMM-score: 17)
    NAD_binding_7; Putative NAD(P)-binding (PF13241; HMM-score: 16.4)
    Thi4; Thi4 family (PF01946; HMM-score: 14.9)
    Lycopene_cycl; Lycopene cyclase protein (PF05834; HMM-score: 13.1)
    TrkA_N; TrkA-N domain (PF02254; HMM-score: 11.4)

Structure, modifications & interactions[edit | edit source]

  • domains:
  • modifications:
  • cofactors: FAD
  • effectors:
  • protein partners:
    SAOUHSC_02494(rpsE)30S ribosomal protein S5  [1] (data from MRSA252)
    SAOUHSC_01040pyruvate dehydrogenase complex, E1 component subunit alpha  [1] (data from MRSA252)
    SAOUHSC_016112-oxoisovalerate dehydrogenase, E2 component, dihydrolipoamide acetyltransferase  [1] (data from MRSA252)
    SAOUHSC_016132-oxoisovalerate dehydrogenase, E1 component subunit alpha  [1] (data from MRSA252)
    SAOUHSC_01801isocitrate dehydrogenase  [1] (data from MRSA252)
    SAOUHSC_01806pyruvate kinase  [1] (data from MRSA252)

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.67
    • Cytoplasmic Membrane Score: 0.01
    • Cellwall Score: 0.15
    • Extracellular Score: 0.17
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 1
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.021285
    • TAT(Tat/SPI): 0.013625
    • LIPO(Sec/SPII): 0.006558
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

Protein sequence[edit | edit source]

  • MSEKQYDLVVLGGGTAGYVAAIRASQLGKKVAIVERQLLGGTCLHKGCIPTKSLLKSAEVFQTVKQAAMFGVDVKDANVNFENMLARKEDIINQMYQGVKHLMQHNHIDIYNGTGRILGTSIFSPQSGTISVEYEDGESDLLPNQFVLIATGSSPAELPFLSFDHDKILSSDDILSLKTLPSSIGIIGGGVIGMEFASLMIDLGVDVTVIEAGERILPTESKQASQLLKKSLSARGVKFYEGIKLSENDINVNEDGVTFEISSDIIKVDKVLLSIGRKPNTSDIGLNNTKIKLSTSGHILTNEFQQTEDKHIYAAGDCIGKLQLAHVGSKEGVVAVDHMFEGNPIPVNYNMMPKCIYSQPEIASIGLNIEQAKAEGMKVKSFKVPFKAIGKAVIDSHDTNEGYSEMVIDQSTEEIVGINMIGPHVTELINEASLLQFMNGSALELGLTTHAHPSISEVLMELGLKAESRAIHV

Experimental data[edit | edit source]

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

  1. 1.0 1.1 1.2 1.3 1.4 1.5 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J Proteome Res: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)
  2. Maren Depke, Stephan Michalik, Alexander Rabe, Kristin Surmann, Lars Brinkmann, Nico Jehmlich, Jörg Bernhardt, Michael Hecker, Bernd Wollscheid, Zhi Sun, Robert L Moritz, Uwe Völker, Frank Schmidt
    A peptide resource for the analysis of Staphylococcus aureus in host-pathogen interaction studies.
    Proteomics: 2015, 15(21);3648-61
    [PubMed:26224020] [WorldCat.org] [DOI] (I p)
  3. Stephan Michalik, Maren Depke, Annette Murr, Manuela Gesell Salazar, Ulrike Kusebauch, Zhi Sun, Tanja C Meyer, Kristin Surmann, Henrike Pförtner, Petra Hildebrandt, Stefan Weiss, Laura Marcela Palma Medina, Melanie Gutjahr, Elke Hammer, Dörte Becher, Thomas Pribyl, Sven Hammerschmidt, Eric W Deutsch, Samuel L Bader, Michael Hecker, Robert L Moritz, Ulrike Mäder, Uwe Völker, Frank Schmidt
    A global Staphylococcus aureus proteome resource applied to the in vivo characterization of host-pathogen interactions.
    Sci Rep: 2017, 7(1);9718
    [PubMed:28887440] [WorldCat.org] [DOI] (I e)
  4. Ulrike Mäder, Pierre Nicolas, Maren Depke, Jan Pané-Farré, Michel Debarbouille, Magdalena M van der Kooi-Pol, Cyprien Guérin, Sandra Dérozier, Aurelia Hiron, Hanne Jarmer, Aurélie Leduc, Stephan Michalik, Ewoud Reilman, Marc Schaffer, Frank Schmidt, Philippe Bessières, Philippe Noirot, Michael Hecker, Tarek Msadek, Uwe Völker, Jan Maarten van Dijl
    Staphylococcus aureus Transcriptome Architecture: From Laboratory to Infection-Mimicking Conditions.
    PLoS Genet: 2016, 12(4);e1005962
    [PubMed:27035918] [WorldCat.org] [DOI] (I e)

Relevant publications[edit | edit source]