From AureoWiki
Jump to navigation Jump to search

NCBI: 03-AUG-2016

Summary[edit | edit source]

  • organism: Staphylococcus aureus NCTC8325
  • locus tag: SAOUHSC_01735
  • pan locus tag?: SAUPAN004231000
  • symbol: SAOUHSC_01735
  • pan gene symbol?: tcdA
  • synonym:
  • product: hypothetical protein

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SAOUHSC_01735
  • symbol: SAOUHSC_01735
  • product: hypothetical protein
  • replicon: chromosome
  • strand: -
  • coordinates: 1638074..1638847
  • length: 774
  • essential: no DEG other strains

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    ATGAAACATCAATTTTCAAGAAATGAACTAGCGATTGGACAACAAGGTTTAGATTTATTG
    AAGCAACAAACTGTTGTCATACTTGGCGTTGGAGGTGTTGGTTCATTTGCTGCTGAAGCA
    TTAGCAAGAACGAATATTGGTCATATTATATTAATAGATAAAGATGATGTTGATATTACA
    AATGTAAACAGACAATTACACGCTTTAACTACAACGGTAGGACAAAGTAAAGTTTCTTTG
    ATGGAAGAACGTATTAAATTAATTAATCCAGATTGTAAAGTCACGCCCTTACATATGTTT
    TATACAGAAGAGACATATGAAGAAATTTTCGATAACTACGATATAGATTATTTTGTAGAT
    GCAAGTGATACAATAATGTACAAAGTACACTTAATGAAAGAGTGTCTTGACCGAGGGATT
    AAAGTGATTTCCAGTATGGGTGCTGCAAATAAAACAGATCCAACACGTTTTACAATTTCA
    GATATCTCTAAAACACATACCGATCCAATGGCCAAAATTATTCGTCAAAAATTGAAAAAA
    CTAGGAATTCGTAAAGGGATTCCAGTTGTATTTTCAGATGAAAGTCCAATTGTCATAAGA
    GAAGATGTAAAAGATATAGTTGGAGATAAAAATGCTATCAATCGAAAAGGACAAATGCCA
    CCTTCTTCAAATGCCTTTGTGCCAAGTGTTGTTGGATTAATTTGTGCAAGTTATGTGGTG
    AATGACGTATTAAAAGATATTCCAGTTCGTCGCATTAAAGACAAAGGGCAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    774

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SAOUHSC_01735
  • symbol: SAOUHSC_01735
  • description: hypothetical protein
  • length: 257
  • theoretical pI: 8.07957
  • theoretical MW: 28641
  • GRAVY: -0.161479

Function[edit | edit source]

  • TIGRFAM:
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Thiamine thiazole biosynthesis adenylyltransferase ThiF (TIGR02356; EC 2.7.7.73; HMM-score: 84.2)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Molybdopterin molybdopterin synthase sulfurylase MoeB (TIGR02355; HMM-score: 77.6)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Thiamine thiamine biosynthesis protein ThiF (TIGR02354; HMM-score: 72.9)
    and 10 more
    PRTRC system ThiF family protein (TIGR03736; HMM-score: 24.1)
    ubiquitin-activating enzyme E1 (TIGR01408; HMM-score: 19.5)
    E1-like protein-activating enzyme Gsa7p/Apg7p (TIGR01381; HMM-score: 18.3)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Heme, porphyrin, and cobalamin glutamyl-tRNA reductase (TIGR01035; EC 1.2.1.70; HMM-score: 17.2)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Pantothenate and coenzyme A 2-dehydropantoate 2-reductase (TIGR00745; EC 1.1.1.-; HMM-score: 16.1)
    Cellular processes Cellular processes Detoxification S-(hydroxymethyl)mycothiol dehydrogenase (TIGR03451; EC 1.1.1.306; HMM-score: 15.3)
    Genetic information processing Protein fate Protein folding and stabilization xanthine dehydrogenase accessory protein XdhC (TIGR02964; HMM-score: 14.3)
    Metabolism Purines, pyrimidines, nucleosides, and nucleotides Other xanthine dehydrogenase accessory protein XdhC (TIGR02964; HMM-score: 14.3)
    6-hydroxycyclohex-1-ene-1-carbonyl-CoA dehydrogenase (TIGR03201; EC 1.1.1.-; HMM-score: 13.5)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Chlorophyll and bacteriochlorphyll geranylgeranyl reductase family (TIGR02032; EC 1.3.1.-; HMM-score: 12.1)
  • TheSEED:  
    RNA Metabolism RNA processing and modification ct6A  CsdL (EC-YgdL) protein of the HesA/MoeB/ThiF family, part of the CsdA-E-L sulfur transfer pathway
    and 1 more
    HesA/MoeB/ThiF family protein
  • PFAM:
    NADP_Rossmann (CL0063) ThiF; ThiF family (PF00899; HMM-score: 115.6)
    and 8 more
    Sacchrp_dh_NADP; Saccharopine dehydrogenase NADP binding domain (PF03435; HMM-score: 22.3)
    TrkA_N; TrkA-N domain (PF02254; HMM-score: 16.9)
    ApbA; Ketopantoate reductase PanE/ApbA (PF02558; HMM-score: 16.5)
    2-Hacid_dh_C; D-isomer specific 2-hydroxyacid dehydrogenase, NAD binding domain (PF02826; HMM-score: 14.6)
    UDPG_MGDP_dh_N; UDP-glucose/GDP-mannose dehydrogenase family, NAD binding domain (PF03721; HMM-score: 14.4)
    Shikimate_DH; Shikimate / quinate 5-dehydrogenase (PF01488; HMM-score: 13.9)
    DAO; FAD dependent oxidoreductase (PF01266; HMM-score: 12.3)
    Trp_halogenase; Tryptophan halogenase (PF04820; HMM-score: 10.6)

Structure, modifications & interactions[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 1
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: -2
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.236347
    • TAT(Tat/SPI): 0.292054
    • LIPO(Sec/SPII): 0.002753
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

Protein sequence[edit | edit source]

  • MKHQFSRNELAIGQQGLDLLKQQTVVILGVGGVGSFAAEALARTNIGHIILIDKDDVDITNVNRQLHALTTTVGQSKVSLMEERIKLINPDCKVTPLHMFYTEETYEEIFDNYDIDYFVDASDTIMYKVHLMKECLDRGIKVISSMGAANKTDPTRFTISDISKTHTDPMAKIIRQKLKKLGIRKGIPVVFSDESPIVIREDVKDIVGDKNAINRKGQMPPSSNAFVPSVVGLICASYVVNDVLKDIPVRRIKDKGQ

Experimental data[edit | edit source]

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

  • SAOUHSC_01735 no polycistronic organisation predicted

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

  1. Maren Depke, Stephan Michalik, Alexander Rabe, Kristin Surmann, Lars Brinkmann, Nico Jehmlich, Jörg Bernhardt, Michael Hecker, Bernd Wollscheid, Zhi Sun, Robert L Moritz, Uwe Völker, Frank Schmidt
    A peptide resource for the analysis of Staphylococcus aureus in host-pathogen interaction studies.
    Proteomics: 2015, 15(21);3648-61
    [PubMed:26224020] [WorldCat.org] [DOI] (I p)
  2. Stephan Michalik, Maren Depke, Annette Murr, Manuela Gesell Salazar, Ulrike Kusebauch, Zhi Sun, Tanja C Meyer, Kristin Surmann, Henrike Pförtner, Petra Hildebrandt, Stefan Weiss, Laura Marcela Palma Medina, Melanie Gutjahr, Elke Hammer, Dörte Becher, Thomas Pribyl, Sven Hammerschmidt, Eric W Deutsch, Samuel L Bader, Michael Hecker, Robert L Moritz, Ulrike Mäder, Uwe Völker, Frank Schmidt
    A global Staphylococcus aureus proteome resource applied to the in vivo characterization of host-pathogen interactions.
    Sci Rep: 2017, 7(1);9718
    [PubMed:28887440] [WorldCat.org] [DOI] (I e)
  3. Ulrike Mäder, Pierre Nicolas, Maren Depke, Jan Pané-Farré, Michel Debarbouille, Magdalena M van der Kooi-Pol, Cyprien Guérin, Sandra Dérozier, Aurelia Hiron, Hanne Jarmer, Aurélie Leduc, Stephan Michalik, Ewoud Reilman, Marc Schaffer, Frank Schmidt, Philippe Bessières, Philippe Noirot, Michael Hecker, Tarek Msadek, Uwe Völker, Jan Maarten van Dijl
    Staphylococcus aureus Transcriptome Architecture: From Laboratory to Infection-Mimicking Conditions.
    PLoS Genet: 2016, 12(4);e1005962
    [PubMed:27035918] [WorldCat.org] [DOI] (I e)

Relevant publications[edit | edit source]