From AureoWiki
Jump to navigation Jump to search

NCBI: 03-AUG-2016

Summary[edit | edit source]

  • organism: Staphylococcus aureus NCTC8325
  • locus tag: SAOUHSC_01778
  • pan locus tag?: SAUPAN004290000
  • symbol: clpX
  • pan gene symbol?: clpX
  • synonym:
  • product: ATP-dependent protease ATP-binding subunit ClpX

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SAOUHSC_01778
  • symbol: clpX
  • product: ATP-dependent protease ATP-binding subunit ClpX
  • replicon: chromosome
  • strand: -
  • coordinates: 1677874..1679136
  • length: 1263
  • essential: no DEG other strains

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    ATGTTTAAATTCAATGAAGATGAAGAAAATTTGAAATGCTCTTTCTGCGGAAAAGACCAA
    GATCAAGTAAAAAAACTTGTAGCAGGAAGTGGTGTATATATTTGTAATGAGTGTATTGAA
    TTATGCTCAGAAATCGTCGAAGAAGAATTAGCTCAAAACACTTCTGAAGCGATGACAGAA
    TTACCTACTCCTAAAGAAATTATGGATCATTTAAACGAATATGTTATTGGTCAAGAAAAA
    GCTAAAAAATCTTTAGCTGTAGCTGTTTATAACCACTATAAGCGTATTCAACAATTAGGA
    CCAAAAGAAGATGATGTTGAATTACAAAAAAGTAACATTGCATTAATTGGGCCAACAGGT
    AGTGGTAAAACATTATTAGCTCAAACCTTAGCCAAGACGTTGAATGTACCATTTGCAATT
    GCAGATGCGACAAGTTTAACTGAAGCTGGTTATGTAGGCGATGATGTTGAAAATATCTTG
    TTGAGATTAATTCAAGCAGCTGACTTTGACATTGATAAAGCCGAAAAAGGTATTATTTAT
    GTAGATGAAATTGATAAAATTGCACGTAAATCTGAAAACACATCTATAACACGTGACGTT
    TCAGGTGAAGGTGTTCAACAAGCATTGCTTAAAATCTTAGAAGGTACGACTGCAAGTGTT
    CCGCCACAAGGTGGACGCAAACATCCAAACCAAGAAATGATTCAAATTGATACAACAAAT
    ATCTTATTTATTCTTGGTGGTGCCTTTGATGGTATTGAAGAAGTGATTAAGCGCCGTCTT
    GGTGAAAAAGTTATTGGTTTCTCAAGCAATGAAGCTGATAAATATGACGAACAAGCATTA
    TTAGCACAAATTCGCCCAGAAGATTTGCAAGCCTATGGTTTGATTCCTGAATTTATCGGA
    CGTGTGCCAATTGTAGCTAATTTAGAAACATTAGATGTAACTGCGTTGAAAAACATCTTA
    ACGCAACCTAAAAATGCACTTGTGAAACAATATACTAAAATGCTGGAATTAGATGATGTG
    GATTTAGAGTTCACTGAAGAAGCTTTATCAGCAATTAGTGAAAAAGCAATTGAAAGAAAA
    ACAGGTGCGCGTGGTTTACGTTCAATCATAGAAGAATCGTTAATCGATATTATGTTTGAT
    GTGCCTTCTAACGAAAATGTAACGAAGGTAGTTATTACAGCACAAACAATTAATGAAGAA
    ACTGAACCAGAACTATACGACGCAGAAGGCAATTTAATTAATAATAGTAAAACATCAGCT
    TAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1263

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SAOUHSC_01778
  • symbol: ClpX
  • description: ATP-dependent protease ATP-binding subunit ClpX
  • length: 420
  • theoretical pI: 4.26448
  • theoretical MW: 46297.2
  • GRAVY: -0.265238

Function[edit | edit source]

  • TIGRFAM:
    Genetic information processing Protein fate Degradation of proteins, peptides, and glycopeptides ATP-dependent Clp protease, ATP-binding subunit ClpX (TIGR00382; HMM-score: 660.9)
    Genetic information processing Protein fate Protein folding and stabilization ATP-dependent Clp protease, ATP-binding subunit ClpX (TIGR00382; HMM-score: 660.9)
    and 25 more
    Genetic information processing Protein fate Protein folding and stabilization ATP-dependent protease HslVU, ATPase subunit (TIGR00390; HMM-score: 212.6)
    Genetic information processing Protein fate Degradation of proteins, peptides, and glycopeptides ATP-dependent Clp protease ATP-binding subunit ClpA (TIGR02639; HMM-score: 46.1)
    Genetic information processing Protein fate Protein folding and stabilization ATP-dependent chaperone protein ClpB (TIGR03346; HMM-score: 36.9)
    Cellular processes Cellular processes Pathogenesis type VI secretion ATPase, ClpV1 family (TIGR03345; HMM-score: 36.2)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking type VI secretion ATPase, ClpV1 family (TIGR03345; HMM-score: 36.2)
    AAA family ATPase, CDC48 subfamily (TIGR01243; HMM-score: 31.4)
    26S proteasome subunit P45 family (TIGR01242; HMM-score: 30)
    Cellular processes Cellular processes Cell division ATP-dependent metallopeptidase HflB (TIGR01241; EC 3.4.24.-; HMM-score: 27.4)
    Genetic information processing Protein fate Degradation of proteins, peptides, and glycopeptides ATP-dependent metallopeptidase HflB (TIGR01241; EC 3.4.24.-; HMM-score: 27.4)
    Genetic information processing DNA metabolism DNA replication, recombination, and repair Holliday junction DNA helicase RuvB (TIGR00635; EC 3.6.4.12; HMM-score: 25.4)
    Genetic information processing Protein fate Degradation of proteins, peptides, and glycopeptides endopeptidase La (TIGR00763; EC 3.4.21.53; HMM-score: 23.8)
    Cellular processes Cellular processes Chemotaxis and motility flagellar biosynthesis protein FlhF (TIGR03499; HMM-score: 23.2)
    Unknown function General Mg chelatase-like protein (TIGR00368; HMM-score: 22.2)
    nicotinamide-nucleotide adenylyltransferase (TIGR01526; EC 2.7.7.1; HMM-score: 21.3)
    Cellular processes Cellular processes Other gas vesicle protein GvpN (TIGR02640; HMM-score: 20.1)
    Genetic information processing Protein fate Degradation of proteins, peptides, and glycopeptides putative ATP-dependent protease (TIGR00764; HMM-score: 16.9)
    Hypothetical proteins Conserved TIGR00270 family protein (TIGR00270; HMM-score: 16.5)
    Genetic information processing DNA metabolism DNA replication, recombination, and repair orc1/cdc6 family replication initiation protein (TIGR02928; HMM-score: 15.8)
    Metabolism Purines, pyrimidines, nucleosides, and nucleotides Nucleotide and nucleoside interconversions cytidylate kinase (TIGR00017; EC 2.7.4.14; HMM-score: 14.5)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking type VII secretion AAA-ATPase EccA (TIGR03922; HMM-score: 13.1)
    Genetic information processing Protein synthesis tRNA and rRNA base modification tRNA dimethylallyltransferase (TIGR00174; EC 2.5.1.75; HMM-score: 12.8)
    Metabolism Transport and binding proteins Anions phosphate ABC transporter, ATP-binding protein (TIGR00972; EC 3.6.3.27; HMM-score: 12.8)
    thiol reductant ABC exporter, CydC subunit (TIGR02868; HMM-score: 12.8)
    Metabolism Transport and binding proteins Anions sulfate ABC transporter, ATP-binding protein (TIGR00968; EC 3.6.3.25; HMM-score: 12.1)
    carbohydrate kinase, thermoresistant glucokinase family (TIGR01313; EC 2.7.1.-; HMM-score: 12.1)
  • TheSEED:  
    Protein Metabolism Protein degradation Proteasome bacterial  ATP-dependent Clp protease ATP-binding subunit ClpX
    and 1 more
    Proteolysis in bacteria, ATP-dependent  ATP-dependent Clp protease ATP-binding subunit ClpX
  • PFAM:
    P-loop_NTPase (CL0023) AAA_2; AAA domain (Cdc48 subfamily) (PF07724; HMM-score: 165)
    and 28 more
    Zn_Beta_Ribbon (CL0167) zf-C4_ClpX; ClpX C4-type zinc finger (PF06689; HMM-score: 67.6)
    P-loop_NTPase (CL0023) AAA; ATPase family associated with various cellular activities (AAA) (PF00004; HMM-score: 59.7)
    no clan defined ClpB_D2-small; C-terminal, D2-small domain, of ClpB protein (PF10431; HMM-score: 59.7)
    P-loop_NTPase (CL0023) AAA_5; AAA domain (dynein-related subfamily) (PF07728; HMM-score: 27.8)
    AAA_22; AAA domain (PF13401; HMM-score: 27.7)
    RuvB_N; Holliday junction DNA helicase ruvB N-terminus (PF05496; HMM-score: 26)
    Mg_chelatase; Magnesium chelatase, subunit ChlI (PF01078; HMM-score: 22.4)
    Sigma54_activat; Sigma-54 interaction domain (PF00158; HMM-score: 18.8)
    AAA_18; AAA domain (PF13238; HMM-score: 18.4)
    MCM; MCM2/3/5 family (PF00493; HMM-score: 18.3)
    IstB_IS21; IstB-like ATP binding protein (PF01695; HMM-score: 17.7)
    TsaE; Threonylcarbamoyl adenosine biosynthesis protein TsaE (PF02367; HMM-score: 17.7)
    AAA_16; AAA ATPase domain (PF13191; HMM-score: 17)
    Sigma54_activ_2; Sigma-54 interaction domain (PF14532; HMM-score: 16.8)
    AAA_14; AAA domain (PF13173; HMM-score: 16.7)
    ABC_tran; ABC transporter (PF00005; HMM-score: 16.5)
    NACHT; NACHT domain (PF05729; HMM-score: 15.8)
    AAA_24; AAA domain (PF13479; HMM-score: 15.1)
    AAA_28; AAA domain (PF13521; HMM-score: 14.1)
    T2SSE; Type II/IV secretion system protein (PF00437; HMM-score: 14)
    AAA_17; AAA domain (PF13207; HMM-score: 14)
    RNA_helicase; RNA helicase (PF00910; HMM-score: 13.8)
    Cytidylate_kin; Cytidylate kinase (PF02224; HMM-score: 13.8)
    AAA_33; AAA domain (PF13671; HMM-score: 13.5)
    PhoH; PhoH-like protein (PF02562; HMM-score: 13.2)
    ResIII; Type III restriction enzyme, res subunit (PF04851; HMM-score: 12.6)
    PduV-EutP; Ethanolamine utilisation - propanediol utilisation (PF10662; HMM-score: 12.6)
    C1 (CL0006) C1_2; C1 domain (PF03107; HMM-score: 11.7)

Structure, modifications & interactions[edit | edit source]

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 1
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.063176
    • TAT(Tat/SPI): 0.001019
    • LIPO(Sec/SPII): 0.00183
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

Protein sequence[edit | edit source]

  • MFKFNEDEENLKCSFCGKDQDQVKKLVAGSGVYICNECIELCSEIVEEELAQNTSEAMTELPTPKEIMDHLNEYVIGQEKAKKSLAVAVYNHYKRIQQLGPKEDDVELQKSNIALIGPTGSGKTLLAQTLAKTLNVPFAIADATSLTEAGYVGDDVENILLRLIQAADFDIDKAEKGIIYVDEIDKIARKSENTSITRDVSGEGVQQALLKILEGTTASVPPQGGRKHPNQEMIQIDTTNILFILGGAFDGIEEVIKRRLGEKVIGFSSNEADKYDEQALLAQIRPEDLQAYGLIPEFIGRVPIVANLETLDVTALKNILTQPKNALVKQYTKMLELDDVDLEFTEEALSAISEKAIERKTGARGLRSIIEESLIDIMFDVPSNENVTKVVITAQTINEETEPELYDAEGNLINNSKTSA

Experimental data[edit | edit source]

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

  1. 1.0 1.1 1.2 1.3 1.4 1.5 1.6 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J Proteome Res: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)
  2. Maren Depke, Stephan Michalik, Alexander Rabe, Kristin Surmann, Lars Brinkmann, Nico Jehmlich, Jörg Bernhardt, Michael Hecker, Bernd Wollscheid, Zhi Sun, Robert L Moritz, Uwe Völker, Frank Schmidt
    A peptide resource for the analysis of Staphylococcus aureus in host-pathogen interaction studies.
    Proteomics: 2015, 15(21);3648-61
    [PubMed:26224020] [WorldCat.org] [DOI] (I p)
  3. Stephan Michalik, Maren Depke, Annette Murr, Manuela Gesell Salazar, Ulrike Kusebauch, Zhi Sun, Tanja C Meyer, Kristin Surmann, Henrike Pförtner, Petra Hildebrandt, Stefan Weiss, Laura Marcela Palma Medina, Melanie Gutjahr, Elke Hammer, Dörte Becher, Thomas Pribyl, Sven Hammerschmidt, Eric W Deutsch, Samuel L Bader, Michael Hecker, Robert L Moritz, Ulrike Mäder, Uwe Völker, Frank Schmidt
    A global Staphylococcus aureus proteome resource applied to the in vivo characterization of host-pathogen interactions.
    Sci Rep: 2017, 7(1);9718
    [PubMed:28887440] [WorldCat.org] [DOI] (I e)
  4. Ulrike Mäder, Pierre Nicolas, Maren Depke, Jan Pané-Farré, Michel Debarbouille, Magdalena M van der Kooi-Pol, Cyprien Guérin, Sandra Dérozier, Aurelia Hiron, Hanne Jarmer, Aurélie Leduc, Stephan Michalik, Ewoud Reilman, Marc Schaffer, Frank Schmidt, Philippe Bessières, Philippe Noirot, Michael Hecker, Tarek Msadek, Uwe Völker, Jan Maarten van Dijl
    Staphylococcus aureus Transcriptome Architecture: From Laboratory to Infection-Mimicking Conditions.
    PLoS Genet: 2016, 12(4);e1005962
    [PubMed:27035918] [WorldCat.org] [DOI] (I e)

Relevant publications[edit | edit source]