From AureoWiki
Jump to navigation Jump to search

NCBI: 03-AUG-2016

⊟Summary[edit | edit source]

  • organism: Staphylococcus aureus NCTC8325
  • locus tag: SAOUHSC_01918
  • pan locus tag?: SAUPAN004514000
  • symbol: SAOUHSC_01918
  • pan gene symbol?: —
  • synonym:
  • product: hypothetical protein

⊟Genome View[edit | edit source]

⊟Gene[edit | edit source]

⊟General[edit | edit source]

  • type: CDS
  • locus tag: SAOUHSC_01918
  • symbol: SAOUHSC_01918
  • product: hypothetical protein
  • replicon: chromosome
  • strand: +
  • coordinates: 1826667..1827317
  • length: 651
  • essential: no DEG other strains

⊟Accession numbers[edit | edit source]

⊟Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

⊟DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    ATGAAAATAACATATAAATATAGAGGAGATTTACCTTTGAATACAGAGAACAACAAGAAT
    CAAAACCAATCTGTTAAAAATTCTGAAAGACGCGGCATGTTAAAAGGATGCGGCGGTTGC
    CTTATTTCTTTTATTTTATTAATAATCTTATTATCAGCCTGTTCAATGATGTTTAGTAAT
    AATGACAATTCCACTAATAATCAATCATCAAAAACGCAATTAACTCAAAAAGATGAAAAT
    AAAAATGAAGATAAGCCTGAGGAAAAATCAGAAACAGCAACAGATGAGGATTTACAATCA
    ACCGAAGAAGTACCTGCAAATGAAAATACTGAAAATAATCAACATGAAATTGATGAAATA
    ACAACAAAAGATCAATCAGACGATGATATTAACACACCAAACGTTGCAGAAGATAAATCA
    CAAGACGACTTGAAAGATGATTTAAAAGAAAAGCAACAATCAAGTAACCATCATCAATCC
    ACGCAACCTAAGACCTCACCATCAACTGAAACAAACACGCAACAATCATTTGCTAATTGT
    AAGCAACTTAGACAAGTATATCCGAATGGTGTCACTGCCGATCATCCAGCATATCGACCA
    CATTTAGATAGAGATAAAGATAAACGTGCATGTGAACCTGATAAATATTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    651

⊟Protein[edit | edit source]

⊟General[edit | edit source]

  • locus tag: SAOUHSC_01918
  • symbol: SAOUHSC_01918
  • description: hypothetical protein
  • length: 216
  • theoretical pI: 4.66027
  • theoretical MW: 24543.5
  • GRAVY: -1.3963

⊟Function[edit | edit source]

  • TIGRFAM:
    Cellular processes Cellular processes Pathogenesis putative immunoglobulin-blocking virulence protein (TIGR04526; HMM-score: 16.2)
    Cellular processes Cellular processes Pathogenesis type III secretion protein, HrcV family (TIGR01399; HMM-score: 14.6)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking type III secretion protein, HrcV family (TIGR01399; HMM-score: 14.6)
    TIGR03943 family protein (TIGR03943; HMM-score: 13.2)
    Cellular processes Cellular processes Cell division cell division protein FtsL (TIGR02209; HMM-score: 13)
    and 5 more
    Cellular processes Cellular processes Cell division cell division protein ZipA (TIGR02205; HMM-score: 10.4)
    Metabolism Transport and binding proteins Cations and iron carrying compounds potassium uptake protein, Trk family (TIGR00934; HMM-score: 5.8)
    Metabolism Transport and binding proteins Nucleosides, purines and pyrimidines nucleoside Transporter (TIGR00939; HMM-score: 5.6)
    Cellular processes Cellular processes Sporulation and germination stage III sporulation protein AF (TIGR02896; HMM-score: 5.4)
    Metabolism Transport and binding proteins Other pleiotropic drug resistance family protein (TIGR00956; HMM-score: 4.7)
  • TheSEED  :
    • Hypothetical protein SAV1799
  • PFAM:
    no clan defined Excalibur; Excalibur calcium-binding domain (PF05901; HMM-score: 46.5)
    and 20 more
    TMEM51; Transmembrane protein 51 (PF15345; HMM-score: 16.1)
    Piezo_RRas_bdg; Piezo non-specific cation channel, R-Ras-binding domain (PF12166; HMM-score: 16)
    FAM176; FAM176 family (PF14851; HMM-score: 15.7)
    CRA; Circumsporozoite-related antigen (CRA) (PF06589; HMM-score: 15.6)
    DUF1510; Protein of unknown function (DUF1510) (PF07423; HMM-score: 11.6)
    DUF4775; Domain of unknown function (DUF4775) (PF16001; HMM-score: 11.3)
    Viral_ssRNA_CP (CL0055) TT_ORF1; TT viral orf 1 (PF02956; HMM-score: 9.9)
    O-anti_assembly (CL0499) O-antigen_lig; O-antigen ligase like membrane protein (PF13425; HMM-score: 9.5)
    DMT (CL0184) Zip; ZIP Zinc transporter (PF02535; HMM-score: 9.1)
    AhpD-like (CL0423) PA26; PA26 p53-induced protein (sestrin) (PF04636; HMM-score: 8.9)
    no clan defined DUF4692; Domain of unknown function (DUF4692) (PF15763; HMM-score: 8.9)
    EphA2_TM; Ephrin type-A receptor 2 transmembrane domain (PF14575; HMM-score: 8.3)
    GPCR_A (CL0192) SID-1_RNA_chan; dsRNA-gated channel SID-1 (PF13965; HMM-score: 8.2)
    no clan defined SLC12; Solute carrier family 12 (PF03522; HMM-score: 7.9)
    SAPS; SIT4 phosphatase-associated protein (PF04499; HMM-score: 7.9)
    SARAF; SOCE-associated regulatory factor of calcium homoeostasis (PF06682; HMM-score: 7.6)
    P-loop_NTPase (CL0023) Hydin_ADK; Hydin Adenylate kinase-like domain (PF17213; HMM-score: 7.2)
    no clan defined G0-G1_switch_2; G0/G1 switch protein 2 (PF15103; HMM-score: 6.8)
    Golgi_traff (CL0456) Hid1; High-temperature-induced dauer-formation protein (PF12722; HMM-score: 6.1)
    no clan defined Macoilin; Macoilin family (PF09726; HMM-score: 5.9)

⊟Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

⊟Localization[edit | edit source]

  • PSORTb: unknown (no significant prediction)
    • Cytoplasmic Score: 2.5
    • Cytoplasmic Membrane Score: 2.5
    • Cellwall Score: 2.5
    • Extracellular Score: 2.5
    • Internal Helix: 1
  • LocateP: Lipid anchored
    • Prediction by SwissProt Classification: Extracellular
    • Pathway Prediction: Sec-(SPII)
    • Intracellular possibility: 0.17
    • Signal peptide possibility: -0.5
    • N-terminally Anchored Score: -1
    • Predicted Cleavage Site: LLSACSM
  • SignalP: Signal peptide LIPO(Sec/SPII) length 53 aa
    • SP(Sec/SPI): 0.043276
    • TAT(Tat/SPI): 0.0134
    • LIPO(Sec/SPII): 0.689809
    • Cleavage Site: CS pos: 53-54. LSA-CS. Pr: 0.6043
  • predicted transmembrane helices (TMHMM): 1

⊟Accession numbers[edit | edit source]

⊟Protein sequence[edit | edit source]

  • MKITYKYRGDLPLNTENNKNQNQSVKNSERRGMLKGCGGCLISFILLIILLSACSMMFSNNDNSTNNQSSKTQLTQKDENKNEDKPEEKSETATDEDLQSTEEVPANENTENNQHEIDEITTKDQSDDDINTPNVAEDKSQDDLKDDLKEKQQSSNHHQSTQPKTSPSTETNTQQSFANCKQLRQVYPNGVTADHPAYRPHLDRDKDKRACEPDKY

⊟Experimental data[edit | edit source]

  • experimentally validated: PeptideAtlas [1] [2]
  • protein localization:
  • quantitative data / protein copy number per cell:
  • interaction partners:

⊟Expression & Regulation[edit | edit source]

⊟Operon[edit | edit source]

⊟Regulation[edit | edit source]

  • regulator:

⊟Transcription pattern[edit | edit source]

⊟Protein synthesis (provided by Aureolib)[edit | edit source]

⊟Protein stability[edit | edit source]

  • half-life: no data available

⊟Biological Material[edit | edit source]

⊟Mutants[edit | edit source]

⊟Expression vector[edit | edit source]

⊟lacZ fusion[edit | edit source]

⊟GFP fusion[edit | edit source]

⊟two-hybrid system[edit | edit source]

⊟FLAG-tag construct[edit | edit source]

⊟Antibody[edit | edit source]

⊟Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

⊟Literature[edit | edit source]

⊟References[edit | edit source]

  1. ↑ Maren Depke, Stephan Michalik, Alexander Rabe, Kristin Surmann, Lars Brinkmann, Nico Jehmlich, Jörg Bernhardt, Michael Hecker, Bernd Wollscheid, Zhi Sun, Robert L Moritz, Uwe Völker, Frank Schmidt
    A peptide resource for the analysis of Staphylococcus aureus in host-pathogen interaction studies.
    Proteomics: 2015, 15(21);3648-61
    [PubMed:26224020] [WorldCat.org] [DOI] (I p)
  2. ↑ Stephan Michalik, Maren Depke, Annette Murr, Manuela Gesell Salazar, Ulrike Kusebauch, Zhi Sun, Tanja C Meyer, Kristin Surmann, Henrike Pförtner, Petra Hildebrandt, Stefan Weiss, Laura Marcela Palma Medina, Melanie Gutjahr, Elke Hammer, Dörte Becher, Thomas Pribyl, Sven Hammerschmidt, Eric W Deutsch, Samuel L Bader, Michael Hecker, Robert L Moritz, Ulrike Mäder, Uwe Völker, Frank Schmidt
    A global Staphylococcus aureus proteome resource applied to the in vivo characterization of host-pathogen interactions.
    Sci Rep: 2017, 7(1);9718
    [PubMed:28887440] [WorldCat.org] [DOI] (I e)
  3. ↑ 3.0 3.1 Ulrike Mäder, Pierre Nicolas, Maren Depke, Jan Pané-Farré, Michel Debarbouille, Magdalena M van der Kooi-Pol, Cyprien Guérin, Sandra Dérozier, Aurelia Hiron, Hanne Jarmer, Aurélie Leduc, Stephan Michalik, Ewoud Reilman, Marc Schaffer, Frank Schmidt, Philippe Bessières, Philippe Noirot, Michael Hecker, Tarek Msadek, Uwe Völker, Jan Maarten van Dijl
    Staphylococcus aureus Transcriptome Architecture: From Laboratory to Infection-Mimicking Conditions.
    PLoS Genet: 2016, 12(4);e1005962
    [PubMed:27035918] [WorldCat.org] [DOI] (I e)

⊟Relevant publications[edit | edit source]

Retrieved from "http://aureowiki.med.uni-greifswald.de/index.php?title=SAOUHSC_01918&oldid=83986"