From AureoWiki
Jump to navigation Jump to search

NCBI: 03-AUG-2016

Summary[edit | edit source]

  • organism: Staphylococcus aureus NCTC8325
  • locus tag: SAOUHSC_01918
  • pan locus tag?: SAUPAN004514000
  • symbol: SAOUHSC_01918
  • pan gene symbol?:
  • synonym:
  • product: hypothetical protein

Additional information (user-provided)[edit | edit source]

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SAOUHSC_01918
  • symbol: SAOUHSC_01918
  • product: hypothetical protein
  • replicon: chromosome
  • strand: +
  • coordinates: 1826667..1827317
  • length: 651
  • essential: no DEG other strains

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Additional information (user-provided)[edit | edit source]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    ATGAAAATAACATATAAATATAGAGGAGATTTACCTTTGAATACAGAGAACAACAAGAAT
    CAAAACCAATCTGTTAAAAATTCTGAAAGACGCGGCATGTTAAAAGGATGCGGCGGTTGC
    CTTATTTCTTTTATTTTATTAATAATCTTATTATCAGCCTGTTCAATGATGTTTAGTAAT
    AATGACAATTCCACTAATAATCAATCATCAAAAACGCAATTAACTCAAAAAGATGAAAAT
    AAAAATGAAGATAAGCCTGAGGAAAAATCAGAAACAGCAACAGATGAGGATTTACAATCA
    ACCGAAGAAGTACCTGCAAATGAAAATACTGAAAATAATCAACATGAAATTGATGAAATA
    ACAACAAAAGATCAATCAGACGATGATATTAACACACCAAACGTTGCAGAAGATAAATCA
    CAAGACGACTTGAAAGATGATTTAAAAGAAAAGCAACAATCAAGTAACCATCATCAATCC
    ACGCAACCTAAGACCTCACCATCAACTGAAACAAACACGCAACAATCATTTGCTAATTGT
    AAGCAACTTAGACAAGTATATCCGAATGGTGTCACTGCCGATCATCCAGCATATCGACCA
    CATTTAGATAGAGATAAAGATAAACGTGCATGTGAACCTGATAAATATTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    651


Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SAOUHSC_01918
  • symbol: SAOUHSC_01918
  • description: hypothetical protein
  • length: 216
  • theoretical pI: 4.66027
  • theoretical MW: 24543.5
  • GRAVY: -1.3963

Function[edit | edit source]

  • TIGRFAM:
    Cellular processes Cellular processes Pathogenesis putative immunoglobulin-blocking virulence protein (TIGR04526; HMM-score: 16.2)
    Cellular processes Cellular processes Pathogenesis type III secretion protein, HrcV family (TIGR01399; HMM-score: 14.6)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking type III secretion protein, HrcV family (TIGR01399; HMM-score: 14.6)
    TIGR03943 family protein (TIGR03943; HMM-score: 13.2)
    Cellular processes Cellular processes Cell division cell division protein FtsL (TIGR02209; HMM-score: 13)
    and 5 more
    Cellular processes Cellular processes Cell division cell division protein ZipA (TIGR02205; HMM-score: 10.4)
    Metabolism Transport and binding proteins Cations and iron carrying compounds potassium uptake protein, Trk family (TIGR00934; HMM-score: 5.8)
    Metabolism Transport and binding proteins Nucleosides, purines and pyrimidines nucleoside Transporter (TIGR00939; HMM-score: 5.6)
    Cellular processes Cellular processes Sporulation and germination stage III sporulation protein AF (TIGR02896; HMM-score: 5.4)
    Metabolism Transport and binding proteins Other pleiotropic drug resistance family protein (TIGR00956; HMM-score: 4.7)
  • TheSEED  :
    • Hypothetical protein SAV1799
  • PFAM:
    no clan defined Excalibur; Excalibur calcium-binding domain (PF05901; HMM-score: 48.6)
    and 14 more
    FAM176; FAM176 family (PF14851; HMM-score: 15.9)
    MAP17; Membrane-associated protein 117 kDa, PDZK1-interacting protein 1 (PF15807; HMM-score: 14.8)
    DUF5850; Family of unknown function (DUF5850) (PF19168; HMM-score: 13.6)
    GPCR_A (CL0192) SID-1_RNA_chan; dsRNA-gated channel SID-1 (PF13965; HMM-score: 10.6)
    Peptidase_AD (CL0130) Presenilin; Presenilin (PF01080; HMM-score: 9.7)
    no clan defined Ac45-VOA1_TM; V0 complex accessory subunit Ac45/VOA1 transmembrane domain (PF20520; HMM-score: 9.6)
    Nucleoplasmin (CL0055) TT_ORF1; TT viral orf 1 (PF02956; HMM-score: 9.5)
    no clan defined CRA; Circumsporozoite-related antigen (CRA) (PF06589; HMM-score: 8.3)
    G0-G1_switch_2; G0/G1 switch protein 2 (PF15103; HMM-score: 8)
    PFF1_TM; Vacuolar membrane protease, transmembrane domain (PF22251; HMM-score: 8)
    AhpD-like (CL0423) PA26; PA26 p53-induced protein (sestrin) (PF04636; HMM-score: 7.7)
    Golgi_traff (CL0456) Hid1; High-temperature-induced dauer-formation protein (PF12722; HMM-score: 7)
    DMT (CL0184) Zip; ZIP Zinc transporter (PF02535; HMM-score: 6.7)
    no clan defined Macoilin; Macoilin family (PF09726; HMM-score: 5.5)

Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

Localization[edit | edit source]

  • PSORTb: unknown (no significant prediction)
    • Cytoplasmic Score: 2.5
    • Cytoplasmic Membrane Score: 2.5
    • Cellwall Score: 2.5
    • Extracellular Score: 2.5
    • Internal Helix: 1
  • DeepLocPro: Extracellular
    • Cytoplasmic Score: 0
    • Cytoplasmic Membrane Score: 0.3591
    • Cell wall & surface Score: 0
    • Extracellular Score: 0.6408
  • LocateP: Lipid anchored
    • Prediction by SwissProt Classification: Extracellular
    • Pathway Prediction: Sec-(SPII)
    • Intracellular possibility: 0.17
    • Signal peptide possibility: -0.5
    • N-terminally Anchored Score: -1
    • Predicted Cleavage Site: LLSACSM
  • SignalP: Signal peptide LIPO(Sec/SPII) length 53 aa
    • SP(Sec/SPI): 0.043276
    • TAT(Tat/SPI): 0.0134
    • LIPO(Sec/SPII): 0.689809
    • Cleavage Site: CS pos: 53-54. LSA-CS. Pr: 0.6043
  • predicted transmembrane helices (TMHMM): 1

Accession numbers[edit | edit source]

Additional information (user-provided)[edit | edit source]

Protein sequence[edit | edit source]

  • MKITYKYRGDLPLNTENNKNQNQSVKNSERRGMLKGCGGCLISFILLIILLSACSMMFSNNDNSTNNQSSKTQLTQKDENKNEDKPEEKSETATDEDLQSTEEVPANENTENNQHEIDEITTKDQSDDDINTPNVAEDKSQDDLKDDLKEKQQSSNHHQSTQPKTSPSTETNTQQSFANCKQLRQVYPNGVTADHPAYRPHLDRDKDKRACEPDKY

Experimental data[edit | edit source]

  • experimentally validated: PeptideAtlas [1] [2]
  • protein localization:
  • quantitative data / protein copy number per cell:
  • interaction partners:

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Additional information (user-provided)[edit | edit source]

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Additional information (user-provided)[edit | edit source]

Other information (user-provided)[edit | edit source]

You can add further information about the gene and protein here. [edit]

Literature[edit | edit source]

References[edit | edit source]

  1. Maren Depke, Stephan Michalik, Alexander Rabe, Kristin Surmann, Lars Brinkmann, Nico Jehmlich, Jörg Bernhardt, Michael Hecker, Bernd Wollscheid, Zhi Sun, Robert L Moritz, Uwe Völker, Frank Schmidt
    A peptide resource for the analysis of Staphylococcus aureus in host-pathogen interaction studies.
    Proteomics: 2015, 15(21);3648-61
    [PubMed:26224020] [WorldCat.org] [DOI] (I p)
  2. Stephan Michalik, Maren Depke, Annette Murr, Manuela Gesell Salazar, Ulrike Kusebauch, Zhi Sun, Tanja C Meyer, Kristin Surmann, Henrike Pförtner, Petra Hildebrandt, Stefan Weiss, Laura Marcela Palma Medina, Melanie Gutjahr, Elke Hammer, Dörte Becher, Thomas Pribyl, Sven Hammerschmidt, Eric W Deutsch, Samuel L Bader, Michael Hecker, Robert L Moritz, Ulrike Mäder, Uwe Völker, Frank Schmidt
    A global Staphylococcus aureus proteome resource applied to the in vivo characterization of host-pathogen interactions.
    Sci Rep: 2017, 7(1);9718
    [PubMed:28887440] [WorldCat.org] [DOI] (I e)
  3. 3.0 3.1 Ulrike Mäder, Pierre Nicolas, Maren Depke, Jan Pané-Farré, Michel Debarbouille, Magdalena M van der Kooi-Pol, Cyprien Guérin, Sandra Dérozier, Aurelia Hiron, Hanne Jarmer, Aurélie Leduc, Stephan Michalik, Ewoud Reilman, Marc Schaffer, Frank Schmidt, Philippe Bessières, Philippe Noirot, Michael Hecker, Tarek Msadek, Uwe Völker, Jan Maarten van Dijl
    Staphylococcus aureus Transcriptome Architecture: From Laboratory to Infection-Mimicking Conditions.
    PLoS Genet: 2016, 12(4);e1005962
    [PubMed:27035918] [WorldCat.org] [DOI] (I e)

Relevant publications[edit | edit source]