From AureoWiki
Jump to navigation Jump to search

NCBI: 03-AUG-2016

Summary[edit | edit source]

  • organism: Staphylococcus aureus NCTC8325
  • locus tag: SAOUHSC_02009
  • pan locus tag?: SAUPAN004854000
  • symbol: SAOUHSC_02009
  • pan gene symbol?:
  • synonym:
  • product: hypothetical protein

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SAOUHSC_02009
  • symbol: SAOUHSC_02009
  • product: hypothetical protein
  • replicon: chromosome
  • strand: -
  • coordinates: 1918269..1919786
  • length: 1518
  • essential: no DEG other strains

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    1381
    1441
    1501
    ATGGGAAGTTCAATTGTTTTAAAGTTACTAAAAGTAACACACTACTATAGGAATAAACAG
    AATAAGAAATGGTATTTACCTTTTGGATATGATGCTGAAGATATCGATTTAAACAATATT
    AGTTTACATATTTATCAAGGAGAAGCATTAGGTATAATTGGTGAACCTGAATCTTCCAAA
    GCGTTGGTAGGTCAATTGTTGGCAGGTGCAATTAAACCTGATAAAGGTAAAGTAGTTTGT
    ACTGAAGATTTGTTCTACGGATATATTGAAGATCAATCGTTAATTCATCAAACTGTTGAA
    GCTTATACAGCGCAGTTAGTTCAACTATTTCCATATGAAATTAATGATCATAAAGCTGAA
    CAGATTATTCAATATGCACATTTAGGTGATTATAAAACGAAGCCGGTTAACCATATTTCG
    AAAGCGGCATACGCTCAATTACTATTAAGTATTGCACGCTCATCAAAATCAAATATTATT
    ATTTTAAATCATGTTATTGACTATTTAACACCACAATTTATGGAACGTGCGATTGAATTA
    ACAAATGATTATATTGAAAATAATTTAACGATTGTGTCAATTGGTGATGATATTGATAAA
    ATTTCACAAGTGAGTAACTACATAGCTTGGTTTTCACATGGTCAATTAAGAATGGAAGGG
    TCACTTAAACAAGTTATTCCATCTTTTAAAGAACATGAACGTGATCGATTAAGTCTAAAC
    TCAAAAGAAGAAATTGAAAACTTTGATTTAGATTGGAAAAAGAATCGTACAAGAATACCA
    GAGATGACCTATAATTTCAAACGTGTTGAGCGCTATAATCATGCAAAACCGCCTAAGTTT
    TTAGTGCGTTTTTGGACTTTAGCCTCAGGTACTATTTTAGGCTTAGCATTGATGATGTTG
    CTCATTTTCAATAATATAGGAATTATTTCGATAACAGATTTTACGAATCGTGCTACGATG
    CAAAATGAAAATAAAGATCCATATGGCGAAAAGTTAGCTTATGGAATTGCTTTTAATGGC
    AGTGTGGATATGCAAGGGGATAAACAAGTCACAATTCCAAAATATAGTGTAGTTACAATT
    ACTGGCGAAAATAGTAAAAATTATCGTGTTACCGCCGATAATAAGACTTACTATGTTAGT
    AAAGATAAATTAGAATATTTTAACCCGGCAGGTTTATATCAAACGCATAGTTTTAAAAAA
    TTAGCACCATATATGAAATCAAATTATAGTAATTACTATGCATACTTTAATAGTCAATTA
    CATAAAAAGCATAGTTCAGTTATAAAAACTTTAGTTCCTGATGATGATAACCGTTTCGTT
    GCATCCGTTACACAACAACCGATACAATTACTTTTCAATGATAATAATCAGTTATACGGT
    TTTGTTTATCCAATTGTAGATAAAAAAGAATTAAAAGATAAGTTTAATATTAACAATAAC
    ATTTGGATTACTAAAGTTGGGAATGGATATTGTATTGCCAATTTGAAAGAAGACAAATGG
    ATTTATATTGAATTGTAG
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380
    1440
    1500
    1518

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SAOUHSC_02009
  • symbol: SAOUHSC_02009
  • description: hypothetical protein
  • length: 505
  • theoretical pI: 8.41277
  • theoretical MW: 58254
  • GRAVY: -0.39604

Function[edit | edit source]

  • TIGRFAM:
    Metabolism Transport and binding proteins Unknown substrate energy-coupling factor transporter ATPase (TIGR04521; EC 3.6.3.-; HMM-score: 43.2)
    Metabolism Transport and binding proteins Unknown substrate energy-coupling factor transporter ATPase (TIGR04520; EC 3.6.3.-; HMM-score: 41)
    and 43 more
    lantibiotic protection ABC transporter, ATP-binding subunit (TIGR03740; HMM-score: 32.9)
    Metabolism Transport and binding proteins Amino acids, peptides and amines urea ABC transporter, ATP-binding protein UrtD (TIGR03411; HMM-score: 30.7)
    Metabolism Transport and binding proteins Other daunorubicin resistance ABC transporter, ATP-binding protein (TIGR01188; HMM-score: 29.1)
    Metabolism Energy metabolism Methanogenesis methyl coenzyme M reductase system, component A2 (TIGR03269; HMM-score: 26)
    Metabolism Transport and binding proteins Cations and iron carrying compounds nickel import ATP-binding protein NikE (TIGR02769; EC 3.6.3.24; HMM-score: 25.5)
    Cellular processes Cellular processes Pathogenesis type I secretion system ATPase (TIGR03375; HMM-score: 24.1)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR03375; HMM-score: 24.1)
    Cell structure Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides lipid A export permease/ATP-binding protein MsbA (TIGR02203; HMM-score: 23.5)
    Metabolism Transport and binding proteins Other lipid A export permease/ATP-binding protein MsbA (TIGR02203; HMM-score: 23.5)
    Metabolism Transport and binding proteins Cations and iron carrying compounds cobalt ABC transporter, ATP-binding protein (TIGR01166; HMM-score: 23.2)
    Metabolism Transport and binding proteins Amino acids, peptides and amines glycine betaine/L-proline transport ATP binding subunit (TIGR01186; HMM-score: 22.8)
    Metabolism Transport and binding proteins Anions phosphate ABC transporter, ATP-binding protein (TIGR00972; EC 3.6.3.27; HMM-score: 22.7)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR01842; HMM-score: 22.3)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR01846; HMM-score: 20.7)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking lipoprotein releasing system, ATP-binding protein (TIGR02211; EC 3.6.3.-; HMM-score: 20.3)
    2-aminoethylphosphonate ABC transport system, ATP-binding component PhnT (TIGR03258; HMM-score: 20.2)
    D-methionine ABC transporter, ATP-binding protein (TIGR02314; EC 3.6.3.-; HMM-score: 19)
    Metabolism Transport and binding proteins Anions nitrate ABC transporter, ATP-binding proteins C and D (TIGR01184; HMM-score: 18.9)
    Metabolism Transport and binding proteins Other nitrate ABC transporter, ATP-binding proteins C and D (TIGR01184; HMM-score: 18.9)
    ATP-binding cassette protein, ChvD family (TIGR03719; HMM-score: 18.1)
    Cellular processes Cellular processes Other nodulation ABC transporter NodI (TIGR01288; HMM-score: 17.7)
    Metabolism Transport and binding proteins Other nodulation ABC transporter NodI (TIGR01288; HMM-score: 17.7)
    thiol reductant ABC exporter, CydC subunit (TIGR02868; HMM-score: 17.3)
    Cellular processes Cellular processes Biosynthesis of natural products NHLM bacteriocin system ABC transporter, peptidase/ATP-binding protein (TIGR03796; HMM-score: 17.2)
    Metabolism Transport and binding proteins Amino acids, peptides and amines NHLM bacteriocin system ABC transporter, peptidase/ATP-binding protein (TIGR03796; HMM-score: 17.2)
    Metabolism Transport and binding proteins Other thiamine ABC transporter, ATP-binding protein (TIGR01277; EC 3.6.3.-; HMM-score: 16.6)
    ectoine/hydroxyectoine ABC transporter, ATP-binding protein EhuA (TIGR03005; HMM-score: 16.1)
    Cell structure Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides LPS export ABC transporter ATP-binding protein (TIGR04406; HMM-score: 15.5)
    Metabolism Transport and binding proteins Other LPS export ABC transporter ATP-binding protein (TIGR04406; HMM-score: 15.5)
    Metabolism Transport and binding proteins Carbohydrates, organic alcohols, and acids D-xylose ABC transporter, ATP-binding protein (TIGR02633; EC 3.6.3.17; HMM-score: 15.2)
    Metabolism Transport and binding proteins Anions sulfate ABC transporter, ATP-binding protein (TIGR00968; EC 3.6.3.25; HMM-score: 14.6)
    Metabolism Central intermediary metabolism Phosphorus compounds phosphonate C-P lyase system protein PhnK (TIGR02323; HMM-score: 14.5)
    Metabolism Transport and binding proteins Anions phosphonate ABC transporter, ATP-binding protein (TIGR02315; EC 3.6.3.28; HMM-score: 14.3)
    Cellular processes Cellular processes Biosynthesis of natural products NHLM bacteriocin system ABC transporter, ATP-binding protein (TIGR03797; HMM-score: 14.2)
    Metabolism Transport and binding proteins Amino acids, peptides and amines NHLM bacteriocin system ABC transporter, ATP-binding protein (TIGR03797; HMM-score: 14.2)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking heme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 13.6)
    Metabolism Transport and binding proteins Other heme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 13.6)
    gliding motility-associated ABC transporter ATP-binding subunit GldA (TIGR03522; HMM-score: 13.2)
    Cellular processes Cellular processes Toxin production and resistance putative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 13)
    Metabolism Transport and binding proteins Unknown substrate putative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 13)
    thiol reductant ABC exporter, CydD subunit (TIGR02857; HMM-score: 12.3)
    Cellular processes Cellular processes Cell division cell division ATP-binding protein FtsE (TIGR02673; HMM-score: 12.2)
    proposed F420-0 ABC transporter, ATP-binding protein (TIGR03873; HMM-score: 11.1)
  • TheSEED:  
    Cell Wall and Capsule Gram-Positive cell wall components Teichoic and lipoteichoic acids biosynthesis  Teichoic acid export ATP-binding protein TagH (EC 3.6.3.40)
    and 1 more
    CBSS-176280.1.peg.1561  Teichoic acid export ATP-binding protein TagH (EC 3.6.3.40)
  • PFAM:
    P-loop_NTPase (CL0023) ABC_tran; ABC transporter (PF00005; HMM-score: 27.1)

Structure, modifications & interactions[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit | edit source]

  • PSORTb: unknown (no significant prediction)
    • Cytoplasmic Score: 2.5
    • Cytoplasmic Membrane Score: 2.5
    • Cellwall Score: 2.5
    • Extracellular Score: 2.5
    • Internal Helix: 1
  • LocateP: Intracellular /TMH start AFTER 60
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: Possibly Sec-
    • Intracellular possibility: 0.17
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.005976
    • TAT(Tat/SPI): 0.000099
    • LIPO(Sec/SPII): 0.00046
  • predicted transmembrane helices (TMHMM): 1

Accession numbers[edit | edit source]

Protein sequence[edit | edit source]

  • MGSSIVLKLLKVTHYYRNKQNKKWYLPFGYDAEDIDLNNISLHIYQGEALGIIGEPESSKALVGQLLAGAIKPDKGKVVCTEDLFYGYIEDQSLIHQTVEAYTAQLVQLFPYEINDHKAEQIIQYAHLGDYKTKPVNHISKAAYAQLLLSIARSSKSNIIILNHVIDYLTPQFMERAIELTNDYIENNLTIVSIGDDIDKISQVSNYIAWFSHGQLRMEGSLKQVIPSFKEHERDRLSLNSKEEIENFDLDWKKNRTRIPEMTYNFKRVERYNHAKPPKFLVRFWTLASGTILGLALMMLLIFNNIGIISITDFTNRATMQNENKDPYGEKLAYGIAFNGSVDMQGDKQVTIPKYSVVTITGENSKNYRVTADNKTYYVSKDKLEYFNPAGLYQTHSFKKLAPYMKSNYSNYYAYFNSQLHKKHSSVIKTLVPDDDNRFVASVTQQPIQLLFNDNNQLYGFVYPIVDKKELKDKFNINNNIWITKVGNGYCIANLKEDKWIYIEL

Experimental data[edit | edit source]

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

  1. Maren Depke, Stephan Michalik, Alexander Rabe, Kristin Surmann, Lars Brinkmann, Nico Jehmlich, Jörg Bernhardt, Michael Hecker, Bernd Wollscheid, Zhi Sun, Robert L Moritz, Uwe Völker, Frank Schmidt
    A peptide resource for the analysis of Staphylococcus aureus in host-pathogen interaction studies.
    Proteomics: 2015, 15(21);3648-61
    [PubMed:26224020] [WorldCat.org] [DOI] (I p)
  2. Stephan Michalik, Maren Depke, Annette Murr, Manuela Gesell Salazar, Ulrike Kusebauch, Zhi Sun, Tanja C Meyer, Kristin Surmann, Henrike Pförtner, Petra Hildebrandt, Stefan Weiss, Laura Marcela Palma Medina, Melanie Gutjahr, Elke Hammer, Dörte Becher, Thomas Pribyl, Sven Hammerschmidt, Eric W Deutsch, Samuel L Bader, Michael Hecker, Robert L Moritz, Ulrike Mäder, Uwe Völker, Frank Schmidt
    A global Staphylococcus aureus proteome resource applied to the in vivo characterization of host-pathogen interactions.
    Sci Rep: 2017, 7(1);9718
    [PubMed:28887440] [WorldCat.org] [DOI] (I e)
  3. Ulrike Mäder, Pierre Nicolas, Maren Depke, Jan Pané-Farré, Michel Debarbouille, Magdalena M van der Kooi-Pol, Cyprien Guérin, Sandra Dérozier, Aurelia Hiron, Hanne Jarmer, Aurélie Leduc, Stephan Michalik, Ewoud Reilman, Marc Schaffer, Frank Schmidt, Philippe Bessières, Philippe Noirot, Michael Hecker, Tarek Msadek, Uwe Völker, Jan Maarten van Dijl
    Staphylococcus aureus Transcriptome Architecture: From Laboratory to Infection-Mimicking Conditions.
    PLoS Genet: 2016, 12(4);e1005962
    [PubMed:27035918] [WorldCat.org] [DOI] (I e)

Relevant publications[edit | edit source]