From AureoWiki
Jump to navigation Jump to search

NCBI: 03-AUG-2016

Summary[edit | edit source]

  • organism: Staphylococcus aureus NCTC8325
  • locus tag: SAOUHSC_02345
  • pan locus tag?: SAUPAN005396000
  • symbol: SAOUHSC_02345
  • pan gene symbol?: atpA
  • synonym:
  • product: F0F1 ATP synthase subunit alpha

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SAOUHSC_02345
  • symbol: SAOUHSC_02345
  • product: F0F1 ATP synthase subunit alpha
  • replicon: chromosome
  • strand: -
  • coordinates: 2170194..2171702
  • length: 1509
  • essential: no DEG other strains

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    1381
    1441
    1501
    ATGGCCATAAAAGCTGAAGAAATCAGTGCATTACTTCGCTCACAAATTGAAAATTATGAG
    TCAGAAATGTCCGTAACTGATGTAGGTACTGTATTACAAATTGGTGATGGTATTGCATTA
    ATTCACGGATTAAATGACGTTATGGCTGGTGAGCTAGTAGAATTCCATAACGGCGTACTT
    GGTTTAGCCCAAAACCTTGAAGAGTCAAACGTGGGTGTGGTTATTTTAGGACCATACACA
    GGTATTACTGAAGGTGACGAAGTTAAACGTACTGGTCGTATCATGGAAGTACCAGTAGGT
    GAAGAACTAATCGGAAGAGTTGTTAATCCATTAGGACAACCTATTGATGGACAAGGACCG
    ATTAACACAACTAAAACACGTCCAGTAGAGAAAAAAGCTACTGGTGTAATGGATCGTAAA
    TCAGTAGATGAGCCATTACAAACAGGTATCAAAGCAATTGATGCTTTAGTACCAATTGGT
    AGAGGTCAACGTGAGTTAATCATCGGTGACCGTCAAACAGGTAAAACAACAATTGCAATT
    GACACAATTTTGAACCAAAAAGATCAAGGTACGATTTGTATCTATGTTGCTATTGGTCAA
    AAAGATTCAACAGTAAGAGCAAATGTTGAAAAGTTAAGACAAGCAGGCGCTTTAGACTAC
    ACTATTGTTGTAGCAGCATCAGCTTCTGAACCTTCTCCATTATTATATATTGCACCATAT
    TCAGGTGTAACAATGGGTGAAGAATTCATGTTTAACGGTAAACATGTTTTAATCGTTTAT
    GATGATTTAACTAAACAAGCAGCAGCTTATCGTGAGTTATCATTATTATTACGTAGACCT
    CCAGGTCGTGAAGCATACCCAGGTGACGTATTCTACTTACATAGTAGATTATTAGAAAGA
    GCAGCAAAATTAAACGATGACTTAGGTGGCGGTTCAATTACTGCATTACCAATTATCGAA
    ACACAAGCTGGTGATATTTCAGCTTATGTACCAACAAACGTTATTTCAATTACAGATGGA
    CAAATCTTCTTACAATCTGATTTATTCTTCTCAGGTGTAAGACCAGCGATTAATGCCGGA
    CAATCTGTATCTCGTGTTGGTGGATCTGCACAAATTAAAGCAATGAAGAAAGTTGCTGGT
    ACGTTACGTCTTGACTTAGCGTCATACAGAGAACTTGAATCATTTGCACAATTCGGTTCA
    GACCTTGATGAATTTACTGCAAGTAAATTAGAACGTGGTAAACGTACTGTTGAAGTCTTA
    AAACAAGATCAAAACAAACCATTACCAGTCGAACACCAAGTGTTGATTATTTATGCATTA
    ACAAAAGGATATTTAGATGATATTCCAGTTGTAGATATCACACGTTTTGAAGACGAGTTA
    AACCACTGGGCAGAATCAAATGCTACTGAACTGTTAAATGAAATCAGAGAAACTGGTGGC
    TTACCAGATGCTGAGAAGTTTGACACAGCAATTAACGAATTCAAAAAAAGCTTTAGCAAA
    TCTGAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380
    1440
    1500
    1509

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SAOUHSC_02345
  • symbol: SAOUHSC_02345
  • description: F0F1 ATP synthase subunit alpha
  • length: 502
  • theoretical pI: 4.62947
  • theoretical MW: 54583.6
  • GRAVY: -0.147809

Function[edit | edit source]

  • reaction:
    EC 3.6.3.14?  ExPASy
    H+-transporting two-sector ATPase ATP + H2O + H+(In) = ADP + phosphate + H+(Out)
  • TIGRFAM:
    Metabolism Energy metabolism ATP-proton motive force interconversion ATP synthase F1, alpha subunit (TIGR00962; EC 3.6.3.14; HMM-score: 836.6)
    and 17 more
    alternate F1F0 ATPase, F1 subunit alpha (TIGR03324; EC 3.6.3.-; HMM-score: 648.9)
    Cellular processes Cellular processes Pathogenesis type III secretion apparatus H+-transporting two-sector ATPase (TIGR02546; EC 3.6.3.14; HMM-score: 205.7)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking type III secretion apparatus H+-transporting two-sector ATPase (TIGR02546; EC 3.6.3.14; HMM-score: 205.7)
    Cellular processes Cellular processes Chemotaxis and motility flagellar protein export ATPase FliI (TIGR03496; EC 3.6.3.14; HMM-score: 199.1)
    Metabolism Energy metabolism ATP-proton motive force interconversion ATPase, FliI/YscN family (TIGR01026; EC 3.6.3.14; HMM-score: 187.6)
    Cellular processes Cellular processes Chemotaxis and motility flagellar protein export ATPase FliI (TIGR03497; EC 3.6.3.14; HMM-score: 183.5)
    flagellar protein export ATPase FliI (TIGR03498; EC 3.6.3.14; HMM-score: 173.7)
    Metabolism Energy metabolism ATP-proton motive force interconversion ATP synthase archaeal, B subunit (TIGR01041; EC 3.6.3.14; HMM-score: 147.9)
    Metabolism Energy metabolism ATP-proton motive force interconversion ATP synthase F1, beta subunit (TIGR01039; EC 3.6.3.14; HMM-score: 130.1)
    alternate F1F0 ATPase, F1 subunit beta (TIGR03305; EC 3.6.3.-; HMM-score: 121.2)
    Metabolism Transport and binding proteins Cations and iron carrying compounds V-type ATPase, B subunit (TIGR01040; EC 3.6.3.14; HMM-score: 119.1)
    Metabolism Energy metabolism ATP-proton motive force interconversion ATP synthase archaeal, A subunit (TIGR01043; EC 3.6.3.14; HMM-score: 69.6)
    Metabolism Transport and binding proteins Cations and iron carrying compounds V-type ATPase, A subunit (TIGR01042; EC 3.6.3.14; HMM-score: 51.8)
    Genetic information processing Transcription Transcription factors transcription termination factor Rho (TIGR00767; EC 3.6.4.-; HMM-score: 19.5)
    KaiC domain protein, AF_0351 family (TIGR03880; HMM-score: 16.3)
    KaiC domain protein, PAE1156 family (TIGR03881; HMM-score: 15.3)
    KaiC domain protein, Ph0284 family (TIGR03877; HMM-score: 13)
  • TheSEED:  
    Respiration ATP synthases F0F1-type ATP synthase  ATP synthase alpha chain (EC 3.6.3.14)
  • PFAM:
    P-loop_NTPase (CL0023) ATP-synt_ab; ATP synthase alpha/beta family, nucleotide-binding domain (PF00006; HMM-score: 246.9)
    and 7 more
    no clan defined ATP-synt_ab_C; ATP synthase alpha/beta chain, C terminal domain (PF00306; HMM-score: 153.1)
    HAS-barrel (CL0275) ATP-synt_ab_N; ATP synthase alpha/beta family, beta-barrel domain (PF02874; HMM-score: 67.1)
    P-loop_NTPase (CL0023) ATPase; KaiC (PF06745; HMM-score: 27.1)
    HAS-barrel (CL0275) HAS-barrel; HAS barrel domain (PF09378; HMM-score: 21.8)
    P-loop_NTPase (CL0023) RecA; recA bacterial DNA recombination protein (PF00154; HMM-score: 13.1)
    AAA_14; AAA domain (PF13173; HMM-score: 12.9)
    AAA_25; AAA domain (PF13481; HMM-score: 11.6)

Structure, modifications & interactions[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 1
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.00179
    • TAT(Tat/SPI): 0.00044
    • LIPO(Sec/SPII): 0.000183
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

Protein sequence[edit | edit source]

  • MAIKAEEISALLRSQIENYESEMSVTDVGTVLQIGDGIALIHGLNDVMAGELVEFHNGVLGLAQNLEESNVGVVILGPYTGITEGDEVKRTGRIMEVPVGEELIGRVVNPLGQPIDGQGPINTTKTRPVEKKATGVMDRKSVDEPLQTGIKAIDALVPIGRGQRELIIGDRQTGKTTIAIDTILNQKDQGTICIYVAIGQKDSTVRANVEKLRQAGALDYTIVVAASASEPSPLLYIAPYSGVTMGEEFMFNGKHVLIVYDDLTKQAAAYRELSLLLRRPPGREAYPGDVFYLHSRLLERAAKLNDDLGGGSITALPIIETQAGDISAYVPTNVISITDGQIFLQSDLFFSGVRPAINAGQSVSRVGGSAQIKAMKKVAGTLRLDLASYRELESFAQFGSDLDEFTASKLERGKRTVEVLKQDQNKPLPVEHQVLIIYALTKGYLDDIPVVDITRFEDELNHWAESNATELLNEIRETGGLPDAEKFDTAINEFKKSFSKSE

Experimental data[edit | edit source]

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

  1. Maren Depke, Stephan Michalik, Alexander Rabe, Kristin Surmann, Lars Brinkmann, Nico Jehmlich, Jörg Bernhardt, Michael Hecker, Bernd Wollscheid, Zhi Sun, Robert L Moritz, Uwe Völker, Frank Schmidt
    A peptide resource for the analysis of Staphylococcus aureus in host-pathogen interaction studies.
    Proteomics: 2015, 15(21);3648-61
    [PubMed:26224020] [WorldCat.org] [DOI] (I p)
  2. Stephan Michalik, Maren Depke, Annette Murr, Manuela Gesell Salazar, Ulrike Kusebauch, Zhi Sun, Tanja C Meyer, Kristin Surmann, Henrike Pförtner, Petra Hildebrandt, Stefan Weiss, Laura Marcela Palma Medina, Melanie Gutjahr, Elke Hammer, Dörte Becher, Thomas Pribyl, Sven Hammerschmidt, Eric W Deutsch, Samuel L Bader, Michael Hecker, Robert L Moritz, Ulrike Mäder, Uwe Völker, Frank Schmidt
    A global Staphylococcus aureus proteome resource applied to the in vivo characterization of host-pathogen interactions.
    Sci Rep: 2017, 7(1);9718
    [PubMed:28887440] [WorldCat.org] [DOI] (I e)
  3. Ulrike Mäder, Pierre Nicolas, Maren Depke, Jan Pané-Farré, Michel Debarbouille, Magdalena M van der Kooi-Pol, Cyprien Guérin, Sandra Dérozier, Aurelia Hiron, Hanne Jarmer, Aurélie Leduc, Stephan Michalik, Ewoud Reilman, Marc Schaffer, Frank Schmidt, Philippe Bessières, Philippe Noirot, Michael Hecker, Tarek Msadek, Uwe Völker, Jan Maarten van Dijl
    Staphylococcus aureus Transcriptome Architecture: From Laboratory to Infection-Mimicking Conditions.
    PLoS Genet: 2016, 12(4);e1005962
    [PubMed:27035918] [WorldCat.org] [DOI] (I e)

Relevant publications[edit | edit source]