From AureoWiki
Jump to navigation Jump to search

NCBI: 03-AUG-2016

Summary[edit | edit source]

  • organism: Staphylococcus aureus NCTC8325
  • locus tag: SAOUHSC_02417
  • pan locus tag?: SAUPAN005553000
  • symbol: SAOUHSC_02417
  • pan gene symbol?: salA
  • synonym:
  • product:

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SAOUHSC_02417
  • symbol: SAOUHSC_02417
  • product:
  • replicon: chromosome
  • strand: -
  • coordinates: 2244813..2245879
  • length: 1065
  • essential: no DEG other strains
  • comment: The sequence of SAOUHSC_02417 was corrected based on the resequencing performed by Berscheid et al., 2012 [1].

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    TTGTTAACGGTAGATCAAGTGAAAGAATTGGTAGGAGAAATTAAAGATCCTATTATAGAT
    GTGCCTTTAAAAGAAACAGAAGGTATTGTTGAAGTTTCTATTAAGGAAGAAAAAGAACAT
    GTGAGTGTTAAATTAGCAATGGCACAATTAGGTGGTGCACCGCAATTAGATTTACAGATG
    GCTGTTGTTAATGCATTAAAAGAAAACGGTGCGAAAACGGTCGGTATACGATTTGAAACA
    TTGCCGGAAGAAAAAGTAAATCAATTTAAACCAAAAGAAGAAAATAAACCTAAAACGATA
    GAAGGCCTATTATCTCAAAATAATCCAGTCGAATTTATTGCAATAGCCTCCGGTAAAGGT
    GGTGTCGGTAAATCTACTGTTGCAGTAAATTTAGCCGTTGCCTTAGCTCGTGAAGGGAAA
    AAAGTCGGATTAGTAGATGCCGATATATATGGATTTAGTGTACCAGATATGATGGGTATT
    GATGAAAAGCCTGGAATTAAAGGGAAGGAAGTAATTCCAGTTGAACGTCATGGCGTTAAA
    GTTATATCAATGGCCTTTTTTGTGGAAGAAAATGCGCCAGTTATATGGAGAGGGCCAATG
    TTAGGTAAAATGTTGACGAATTTCTTTACAGAAGTTAAATGGGGAGACATTGAATATTTA
    ATACTCGATCTTCCACCTGGAACAGGAGATGTAGCTTTAGATGTTCATACGATGTTACCT
    TCAAGTAAGGAAATTATTGTAACGACACCTCATCCTACAGCAGCATTTGTTGCAGCTCGC
    GCAGGTGCGATGGCAAAACATACGGATCATTCTATTCTTGGCGTAATTGAAAACATGAGT
    TATTTTGAAAGTAAAGAGACGGGTAATAAAGAATATGTCTTTGGCAAAGGTGGCGGTACT
    AAGTTAGCTGATGAACTTAATACTCAATTACTTGGGGAATTACCTTTAGAGCAACCATCT
    TGGAATCCAAAAGATTTTGCACCGTCAATATATCAATCAGATGATCGTCTAGGTAAAATT
    TATAGCTCGATTGCACAAAAAGTTATAGCTGCTACAAATAAATAG
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1065

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SAOUHSC_02417
  • symbol: SAOUHSC_02417
  • description:
  • length: 354
  • theoretical pI: 5.069
  • theoretical MW: 38358
  • GRAVY: -0.121751

Function[edit | edit source]

  • TIGRFAM:
    cell division ATPase MinD (TIGR01969; HMM-score: 69.8)
    and 20 more
    Cellular processes Cellular processes Cell division septum site-determining protein MinD (TIGR01968; HMM-score: 51.2)
    helicase/secretion neighborhood CpaE-like protein (TIGR03815; HMM-score: 44.9)
    Metabolism Transport and binding proteins Carbohydrates, organic alcohols, and acids capsular exopolysaccharide family (TIGR01007; HMM-score: 36.8)
    exopolysaccharide/PEP-CTERM locus tyrosine autokinase (TIGR03018; EC 2.7.10.2; HMM-score: 35.3)
    Cell structure Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides cellulose synthase operon protein YhjQ (TIGR03371; HMM-score: 29.9)
    arsenical pump-driving ATPase (TIGR04291; EC 3.6.1.-; HMM-score: 28.1)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Chlorophyll and bacteriochlorphyll light-independent protochlorophyllide reductase, iron-sulfur ATP-binding protein (TIGR01281; EC 1.3.7.7; HMM-score: 27.8)
    Hypothetical proteins Conserved transport-energizing ATPase, TRC40/GET3/ArsA family (TIGR00345; EC 3.6.1.-; HMM-score: 25.7)
    Metabolism Transport and binding proteins Carbohydrates, organic alcohols, and acids exopolysaccharide transport protein family (TIGR01005; HMM-score: 25.7)
    Metabolism Central intermediary metabolism Nitrogen fixation nitrogenase iron protein (TIGR01287; EC 1.18.6.1; HMM-score: 23.8)
    chain length determinant protein tyrosine kinase EpsG (TIGR03029; HMM-score: 21.5)
    Genetic information processing Mobile and extrachromosomal element functions Plasmid functions plasmid partitioning protein RepA (TIGR03453; HMM-score: 17.9)
    DNA repair and recombination protein RadB (TIGR02237; HMM-score: 16.4)
    Metabolism Energy metabolism Photosynthesis chlorophyllide reductase iron protein subunit X (TIGR02016; HMM-score: 16.2)
    Metabolism Transport and binding proteins Amino acids, peptides and amines LAO/AO transport system ATPase (TIGR00750; EC 2.7.-.-; HMM-score: 15.9)
    Signal transduction Regulatory functions Protein interactions LAO/AO transport system ATPase (TIGR00750; EC 2.7.-.-; HMM-score: 15.9)
    Cellular processes Cellular processes Chemotaxis and motility flagellar biosynthesis protein FlhF (TIGR03499; HMM-score: 15)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking signal recognition particle-docking protein FtsY (TIGR00064; HMM-score: 14.1)
    Metabolism Central intermediary metabolism Sulfur metabolism adenylyl-sulfate kinase (TIGR00455; EC 2.7.1.25; HMM-score: 12.7)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Heme, porphyrin, and cobalamin putative heme d1 biosynthesis radical SAM protein NirJ2 (TIGR04055; EC 1.3.99.-; HMM-score: 12.6)
  • TheSEED:  
    Scaffold protein for [4Fe-4S] cluster assembly ApbC, MRP-like
  • PFAM:
    P-loop_NTPase (CL0023) ParA; NUBPL iron-transfer P-loop NTPase (PF10609; HMM-score: 289.2)
    and 17 more
    CbiA; CobQ/CobB/MinD/ParA nucleotide binding domain (PF01656; HMM-score: 52.5)
    AAA_31; AAA domain (PF13614; HMM-score: 45.2)
    MipZ; ATPase MipZ (PF09140; HMM-score: 32.1)
    Fer4_NifH; 4Fe-4S iron sulfur cluster binding proteins, NifH/frxC family (PF00142; HMM-score: 27.2)
    ArsA_ATPase; Anion-transporting ATPase (PF02374; HMM-score: 27.2)
    AAA_25; AAA domain (PF13481; HMM-score: 21.3)
    VirC1; VirC1 protein (PF07015; HMM-score: 20.4)
    CLP1_P; mRNA cleavage and polyadenylation factor CLP1 P-loop (PF16575; HMM-score: 18.8)
    CBP_BcsQ; Cellulose biosynthesis protein BcsQ (PF06564; HMM-score: 18.1)
    SRP54; SRP54-type protein, GTPase domain (PF00448; HMM-score: 16.4)
    ArgK; ArgK protein (PF03308; HMM-score: 15.1)
    APS_kinase; Adenylylsulphate kinase (PF01583; HMM-score: 13.4)
    IstB_IS21; IstB-like ATP binding protein (PF01695; HMM-score: 12.6)
    no clan defined PilZ; PilZ domain (PF07238; HMM-score: 12.6)
    P-loop_NTPase (CL0023) KTI12; Chromatin associated protein KTI12 (PF08433; HMM-score: 12.1)
    PhoH; PhoH-like protein (PF02562; HMM-score: 11.9)
    NB-ARC; NB-ARC domain (PF00931; HMM-score: 11.3)

Structure, modifications & interactions[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 1
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.003818
    • TAT(Tat/SPI): 0.000508
    • LIPO(Sec/SPII): 0.000224
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

  • GI:
  • RefSeq:
  • UniProt: Q2FW86 UniProt
  • STRING: 1280.SAXN108_2413 STRING

Protein sequence[edit | edit source]

  • MLTVDQVKELVGEIKDPIIDVPLKETEGIVEVSIKEEKEHVSVKLAMAQLGGAPQLDLQMAVVNALKENGAKTVGIRFETLPEEKVNQFKPKEENKPKTIEGLLSQNNPVEFIAIASGKGGVGKSTVAVNLAVALAREGKKVGLVDADIYGFSVPDMMGIDEKPGIKGKEVIPVERHGVKVISMAFFVEENAPVIWRGPMLGKMLTNFFTEVKWGDIEYLILDLPPGTGDVALDVHTMLPSSKEIIVTTPHPTAAFVAARAGAMAKHTDHSILGVIENMSYFESKETGNKEYVFGKGGGTKLADELNTQLLGELPLEQPSWNPKDFAPSIYQSDDRLGKIYSSIAQKVIAATNK

Experimental data[edit | edit source]

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

  • SAOUHSC_02417 no polycistronic organisation predicted

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

  1. Anne Berscheid, Peter Sass, Konstantin Weber-Lassalle, Ambrose L Cheung, Gabriele Bierbaum
    Revisiting the genomes of the Staphylococcus aureus strains NCTC 8325 and RN4220.
    Int J Med Microbiol: 2012, 302(2);84-7
    [PubMed:22417616] [WorldCat.org] [DOI] (I p)
  2. Maren Depke, Stephan Michalik, Alexander Rabe, Kristin Surmann, Lars Brinkmann, Nico Jehmlich, Jörg Bernhardt, Michael Hecker, Bernd Wollscheid, Zhi Sun, Robert L Moritz, Uwe Völker, Frank Schmidt
    A peptide resource for the analysis of Staphylococcus aureus in host-pathogen interaction studies.
    Proteomics: 2015, 15(21);3648-61
    [PubMed:26224020] [WorldCat.org] [DOI] (I p)
  3. Stephan Michalik, Maren Depke, Annette Murr, Manuela Gesell Salazar, Ulrike Kusebauch, Zhi Sun, Tanja C Meyer, Kristin Surmann, Henrike Pförtner, Petra Hildebrandt, Stefan Weiss, Laura Marcela Palma Medina, Melanie Gutjahr, Elke Hammer, Dörte Becher, Thomas Pribyl, Sven Hammerschmidt, Eric W Deutsch, Samuel L Bader, Michael Hecker, Robert L Moritz, Ulrike Mäder, Uwe Völker, Frank Schmidt
    A global Staphylococcus aureus proteome resource applied to the in vivo characterization of host-pathogen interactions.
    Sci Rep: 2017, 7(1);9718
    [PubMed:28887440] [WorldCat.org] [DOI] (I e)
  4. Ulrike Mäder, Pierre Nicolas, Maren Depke, Jan Pané-Farré, Michel Debarbouille, Magdalena M van der Kooi-Pol, Cyprien Guérin, Sandra Dérozier, Aurelia Hiron, Hanne Jarmer, Aurélie Leduc, Stephan Michalik, Ewoud Reilman, Marc Schaffer, Frank Schmidt, Philippe Bessières, Philippe Noirot, Michael Hecker, Tarek Msadek, Uwe Völker, Jan Maarten van Dijl
    Staphylococcus aureus Transcriptome Architecture: From Laboratory to Infection-Mimicking Conditions.
    PLoS Genet: 2016, 12(4);e1005962
    [PubMed:27035918] [WorldCat.org] [DOI] (I e)

Relevant publications[edit | edit source]