From AureoWiki
Jump to navigation Jump to search

NCBI: 03-AUG-2016

⊟Summary[edit | edit source]

  • organism: Staphylococcus aureus NCTC8325
  • locus tag: SAOUHSC_02724
  • pan locus tag?: SAUPAN005981000
  • symbol: SAOUHSC_02724
  • pan gene symbol?: —
  • synonym:
  • product: hypothetical protein

⊟Genome View[edit | edit source]

⊟Gene[edit | edit source]

⊟General[edit | edit source]

  • type: CDS
  • locus tag: SAOUHSC_02724
  • symbol: SAOUHSC_02724
  • product: hypothetical protein
  • replicon: chromosome
  • strand: +
  • coordinates: 2504707..2505366
  • length: 660
  • essential: no DEG other strains

⊟Accession numbers[edit | edit source]

⊟Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

⊟DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    ATGAAAAGAACTGATAAATACCGTGATTCATATCAATACGACAATCAAAACCAAAATCAT
    CGTCGTCAATCTGAAGACGCATCGTATAGACAACAATATGCTAAAGGCGATCCTGAAGAA
    CACCCGGAACGATACTATAATGGTAGAGATTATCGAAGAGAACAAATTCTTGAAGAAGAA
    AACGAGAAATCCCGCCGTTCAAAAAAATGGTTATATATCATTATTGCCATTCTCTTAATT
    ATTGTCGCTATTTTTGTCACACGCGCCTTACTTAACAATGATAGCGATAAAGTTAGTAAT
    GACCCTAAAGTCTCTCAAAATTATAAAAAACAAGTTGAAAATCAAGACGGCCAAATTAAC
    CAGCAAGTAGATAATGCTAAAGAAAATATTAAAAACAACCAAAAAACTGATGACATTATT
    AAAAATTTACAAAATCAAATCGACAACTTGAAGCAGCAAGAACAAAACAAAGCTGATTCT
    AAGCTAACTCAATTTTATCAAGACCAAATCAACAAATTGACAGAGGCAAATAATGCACTT
    AAAAACAATGCAAGCCAAGGTAAAATTGAAAGCATGTTAAATGATATTAATACAAAATTC
    GACAGTATTAAATCTAAATTAGAAAGCTTATTTAAAGATGACAATGGTGGCGCTAATTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660

⊟Protein[edit | edit source]

⊟General[edit | edit source]

  • locus tag: SAOUHSC_02724
  • symbol: SAOUHSC_02724
  • description: hypothetical protein
  • length: 219
  • theoretical pI: 8.61585
  • theoretical MW: 25799.2
  • GRAVY: -1.38402

⊟Function[edit | edit source]

  • TIGRFAM:
    TIGR03943 family protein (TIGR03943; HMM-score: 15.1)
    Genetic information processing Protein fate Protein folding and stabilization cytochrome c-type biogenesis protein CcmI (TIGR03142; HMM-score: 14.6)
    Metabolism Energy metabolism Electron transport cytochrome c-type biogenesis protein CcmI (TIGR03142; HMM-score: 14.6)
    Metabolism Transport and binding proteins Carbohydrates, organic alcohols, and acids PTS system, glucose-specific IIBC component (TIGR02002; EC 2.7.1.69; HMM-score: 13.7)
    and 11 more
    Cellular processes Cellular processes Pathogenesis type IV/VI secretion system protein, DotU family (TIGR03349; HMM-score: 11.6)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking type IV/VI secretion system protein, DotU family (TIGR03349; HMM-score: 11.6)
    Cellular processes Cellular processes Toxin production and resistance thiopeptide-type bacteriocin biosynthesis domain (TIGR03891; HMM-score: 11.1)
    Hypothetical proteins Conserved TIGR00366 family protein (TIGR00366; HMM-score: 10.5)
    Metabolism Transport and binding proteins Carbohydrates, organic alcohols, and acids D-galactonate transporter (TIGR00893; HMM-score: 10)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Other C-3',4' desaturase CrtD (TIGR02733; EC 1.3.99.-; HMM-score: 10)
    conjugal transfer/type IV secretion protein DotA/TraY (TIGR04346; HMM-score: 9.1)
    phage lysis regulatory protein, LysB family (TIGR03495; HMM-score: 5.6)
    two transmembrane protein (TIGR04527; HMM-score: 4.7)
    Cellular processes Cellular processes Pathogenesis type III secretion apparatus protein, YscR/HrcR family (TIGR01102; HMM-score: 4)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking type III secretion apparatus protein, YscR/HrcR family (TIGR01102; HMM-score: 4)
  • TheSEED  :
    • FIG01107902: hypothetical protein
  • PFAM:
    no clan defined DUF1510; Protein of unknown function (DUF1510) (PF07423; HMM-score: 26.3)
    and 28 more
    FRB_dom; FKBP12-rapamycin binding domain (PF08771; HMM-score: 20)
    Med9; RNA polymerase II transcription mediator complex subunit 9 (PF07544; HMM-score: 18.3)
    Peptidase_MA (CL0126) DUF3810; Protein of unknown function (DUF3810) (PF12725; HMM-score: 17.5)
    no clan defined GlutR_dimer; Glutamyl-tRNAGlu reductase, dimerisation domain (PF00745; HMM-score: 17.3)
    Amnionless; Amnionless (PF14828; HMM-score: 16.9)
    ATP_synthase (CL0255) ATP-synt_B; ATP synthase B/B' CF(0) (PF00430; HMM-score: 16.3)
    no clan defined SNARE; SNARE domain (PF05739; HMM-score: 16.2)
    DUF4094; Domain of unknown function (DUF4094) (PF13334; HMM-score: 16.2)
    DUF2408; Protein of unknown function (DUF2408) (PF10303; HMM-score: 14.3)
    DUF4446; Protein of unknown function (DUF4446) (PF14584; HMM-score: 14.2)
    MFS (CL0015) MFS_Mycoplasma; Mycoplasma MFS transporter (PF07672; HMM-score: 14.1)
    ABC-2 (CL0181) ABC2_membrane_3; ABC-2 family transporter protein (PF12698; HMM-score: 14)
    no clan defined DUF948; Bacterial protein of unknown function (DUF948) (PF06103; HMM-score: 13.7)
    ATP_synthase (CL0255) HrpE; HrpE/YscL/FliH and V-type ATPase subunit E (PF06188; HMM-score: 12.5)
    PepSY_TM-like (CL0490) PepSY_TM_like_2; Putative PepSY_TM-like (PF16357; HMM-score: 12.5)
    no clan defined SARAF; SOCE-associated regulatory factor of calcium homoeostasis (PF06682; HMM-score: 12.2)
    ABC-2 (CL0181) ABC2_membrane_2; ABC-2 family transporter protein (PF12679; HMM-score: 11.7)
    Zn_Beta_Ribbon (CL0167) DUF2116; Uncharacterized protein containing a Zn-ribbon (DUF2116) (PF09889; HMM-score: 11.6)
    GPCR_A (CL0192) SID-1_RNA_chan; dsRNA-gated channel SID-1 (PF13965; HMM-score: 11.5)
    IT (CL0182) SCFA_trans; Short chain fatty acid transporter (PF02667; HMM-score: 10.5)
    no clan defined YtxH; YtxH-like protein (PF12732; HMM-score: 10.1)
    FUN14; FUN14 family (PF04930; HMM-score: 9.7)
    SapB_1; Saposin-like type B, region 1 (PF05184; HMM-score: 8.9)
    DUF5469; Family of unknown function (DUF5469) (PF17561; HMM-score: 8.3)
    PP2C_C; Protein serine/threonine phosphatase 2C, C-terminal domain (PF07830; HMM-score: 7.3)
    DUF3899; Domain of unknown function (DUF3899) (PF13038; HMM-score: 7.2)
    Not1; CCR4-Not complex component, Not1 (PF04054; HMM-score: 7.1)
    Vma12; Endoplasmic reticulum-based factor for assembly of V-ATPase (PF11712; HMM-score: 6.8)

⊟Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

⊟Localization[edit | edit source]

  • PSORTb: unknown (no significant prediction)
    • Cytoplasmic Score: 2.5
    • Cytoplasmic Membrane Score: 2.5
    • Cellwall Score: 2.5
    • Extracellular Score: 2.5
    • Internal Helix: 1
  • LocateP: Intracellular /TMH start AFTER 60
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: Possibly Sec-
    • Intracellular possibility: 0.17
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: -1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.023157
    • TAT(Tat/SPI): 0.00401
    • LIPO(Sec/SPII): 0.008892
  • predicted transmembrane helices (TMHMM): 1

⊟Accession numbers[edit | edit source]

⊟Protein sequence[edit | edit source]

  • MKRTDKYRDSYQYDNQNQNHRRQSEDASYRQQYAKGDPEEHPERYYNGRDYRREQILEEENEKSRRSKKWLYIIIAILLIIVAIFVTRALLNNDSDKVSNDPKVSQNYKKQVENQDGQINQQVDNAKENIKNNQKTDDIIKNLQNQIDNLKQQEQNKADSKLTQFYQDQINKLTEANNALKNNASQGKIESMLNDINTKFDSIKSKLESLFKDDNGGAN

⊟Experimental data[edit | edit source]

  • experimentally validated: PeptideAtlas [1] [2]
  • protein localization: data available for COL
  • quantitative data / protein copy number per cell: data available for COL
  • interaction partners:

⊟Expression & Regulation[edit | edit source]

⊟Operon[edit | edit source]

⊟Regulation[edit | edit source]

  • regulator:

⊟Transcription pattern[edit | edit source]

⊟Protein synthesis (provided by Aureolib)[edit | edit source]

⊟Protein stability[edit | edit source]

  • half-life: no data available

⊟Biological Material[edit | edit source]

⊟Mutants[edit | edit source]

⊟Expression vector[edit | edit source]

⊟lacZ fusion[edit | edit source]

⊟GFP fusion[edit | edit source]

⊟two-hybrid system[edit | edit source]

⊟FLAG-tag construct[edit | edit source]

⊟Antibody[edit | edit source]

⊟Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

⊟Literature[edit | edit source]

⊟References[edit | edit source]

  1. ↑ Maren Depke, Stephan Michalik, Alexander Rabe, Kristin Surmann, Lars Brinkmann, Nico Jehmlich, Jörg Bernhardt, Michael Hecker, Bernd Wollscheid, Zhi Sun, Robert L Moritz, Uwe Völker, Frank Schmidt
    A peptide resource for the analysis of Staphylococcus aureus in host-pathogen interaction studies.
    Proteomics: 2015, 15(21);3648-61
    [PubMed:26224020] [WorldCat.org] [DOI] (I p)
  2. ↑ Stephan Michalik, Maren Depke, Annette Murr, Manuela Gesell Salazar, Ulrike Kusebauch, Zhi Sun, Tanja C Meyer, Kristin Surmann, Henrike Pförtner, Petra Hildebrandt, Stefan Weiss, Laura Marcela Palma Medina, Melanie Gutjahr, Elke Hammer, Dörte Becher, Thomas Pribyl, Sven Hammerschmidt, Eric W Deutsch, Samuel L Bader, Michael Hecker, Robert L Moritz, Ulrike Mäder, Uwe Völker, Frank Schmidt
    A global Staphylococcus aureus proteome resource applied to the in vivo characterization of host-pathogen interactions.
    Sci Rep: 2017, 7(1);9718
    [PubMed:28887440] [WorldCat.org] [DOI] (I e)
  3. ↑ Ulrike Mäder, Pierre Nicolas, Maren Depke, Jan Pané-Farré, Michel Debarbouille, Magdalena M van der Kooi-Pol, Cyprien Guérin, Sandra Dérozier, Aurelia Hiron, Hanne Jarmer, Aurélie Leduc, Stephan Michalik, Ewoud Reilman, Marc Schaffer, Frank Schmidt, Philippe Bessières, Philippe Noirot, Michael Hecker, Tarek Msadek, Uwe Völker, Jan Maarten van Dijl
    Staphylococcus aureus Transcriptome Architecture: From Laboratory to Infection-Mimicking Conditions.
    PLoS Genet: 2016, 12(4);e1005962
    [PubMed:27035918] [WorldCat.org] [DOI] (I e)

⊟Relevant publications[edit | edit source]

Retrieved from "http://aureowiki.med.uni-greifswald.de/index.php?title=SAOUHSC_02724&oldid=98928"