From AureoWiki
Jump to navigation Jump to search

NCBI: 03-AUG-2016

Summary[edit | edit source]

  • organism: Staphylococcus aureus NCTC8325
  • locus tag: SAOUHSC_02904
  • pan locus tag?: SAUPAN006262000
  • symbol: SAOUHSC_02904
  • pan gene symbol?:
  • synonym:
  • product: hypothetical protein

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SAOUHSC_02904
  • symbol: SAOUHSC_02904
  • product: hypothetical protein
  • replicon: chromosome
  • strand: -
  • coordinates: 2672670..2673776
  • length: 1107
  • essential: no DEG other strains

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    ATGCAACATCATAAAGTGGCTATTATCGGTGCCGGTGCTGCAGGTATAGGTATGGCCATT
    ACCTTAAAAGATTTCGGTATAACAGATGTCATTATTTTAGAAAAAGGAACAGTAGGACAT
    TCATTTAAACATTGGCCGAAATCGACCCGTACGATCACGCCATCATTTACGTCTAATGGA
    TTTGGCATGCCTGATATGAATGCAATTTCCATGGATACTTCACCAGCATTTACATTTAAT
    GAAGAACATATTTCCGGAGAAACATATGCTGAATATTTACAAGTGGTTGCCAACCATTAC
    GAGCTGAATATCTTTGAAAATACAGTTGTCACAAATATATCTGTAGATGATGCATATTAT
    ACGATTGCAACGACAACAGAGATATATCACGCGGATTATATCTTTGTCGCAACAGGTGAT
    TATAATTTCCCTAAAAAGCCATTTAAATATGGTATTCATTATAGTGAAATTGAAGACTTT
    GATAACTTTAATAAGGGGCAATATGTGGTTATCGGAGGTAATGAAAGTGGCTTTGATGCT
    GCATATCAACTTGCAAAAAATGGCTCTGACATCGCACTTTATACTAGCACAACCGGTTTA
    AATGATCCGGATGCTGATCCTAGTGTTAGATTGTCACCTTATACACGTCAGCGACTAGGT
    AATGTCATTAAGCAAGGTGCTCGCATCGAAATGAATGTACATTATACAGTTAAAGATATT
    GATTTTAACAATGGACAGTATCATATCAGTTTTGATAGCGGACAAAGTGTGCTTACACCT
    CATGAACCAATACTAGCAACTGGCTTTGATGCAACAAAAAATCCAATCGTTCAACAATTA
    TTTGTGACAACAAATCAAGATATTAAATTAACAACACATGATGAATCGACACGTTATCCG
    AATATTTTTATGATTGGTGCAACAGTTGAAAATGATAATGCCAAATTATGCTATATCTAT
    AAATTTAGAGCGCGATTTGCAGTACTTGCACATCTTTTAACACAGCGGGAAGGCTTACCA
    GCTAAACAAGATGTCATTGAAAATTATCAAAAAAATCAAATGTATTTAGATGATTATTCA
    TGTTGTGAAGTGTCATGCACATGTTAG
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1107

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SAOUHSC_02904
  • symbol: SAOUHSC_02904
  • description: hypothetical protein
  • length: 368
  • theoretical pI: 5.0566
  • theoretical MW: 41168.8
  • GRAVY: -0.294565

Function[edit | edit source]

  • TIGRFAM:
    Unknown function Enzymes of unknown specificity putative bacillithiol system oxidoreductase, YpdA family (TIGR04018; EC 1.8.-.-; HMM-score: 94.3)
    and 34 more
    flavin-dependent oxidoreductase, MSMEG_0569 family (TIGR04046; HMM-score: 51.8)
    Unknown function Enzymes of unknown specificity flavoprotein, HI0933 family (TIGR00275; HMM-score: 36.6)
    Metabolism Energy metabolism Electron transport thioredoxin-disulfide reductase (TIGR01292; EC 1.8.1.9; HMM-score: 32.3)
    Cellular processes Cellular processes Detoxification mercury(II) reductase (TIGR02053; EC 1.16.1.1; HMM-score: 25.8)
    Cellular processes Cellular processes Detoxification alkyl hydroperoxide reductase subunit F (TIGR03140; EC 1.8.1.-; HMM-score: 23.7)
    Cellular processes Cellular processes Adaptations to atypical conditions alkyl hydroperoxide reductase subunit F (TIGR03140; EC 1.8.1.-; HMM-score: 23.7)
    squalene-associated FAD-dependent desaturase (TIGR03467; HMM-score: 20.1)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Chlorophyll and bacteriochlorphyll geranylgeranyl reductase family (TIGR02032; EC 1.3.1.-; HMM-score: 19.7)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Thiamine thiazole biosynthesis enzyme (TIGR00292; HMM-score: 19.4)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Pyridine nucleotides L-aspartate oxidase (TIGR00551; EC 1.4.3.16; HMM-score: 19.2)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Menaquinone and ubiquinone 2-polyprenyl-6-methoxyphenol 4-hydroxylase (TIGR01984; EC 1.14.13.-; HMM-score: 18.9)
    dihydrolipoyl dehydrogenase (TIGR01350; EC 1.8.1.4; HMM-score: 18.6)
    putative selenate reductase, YgfK subunit (TIGR03315; HMM-score: 17.9)
    Metabolism Energy metabolism Amino acids and amines sarcosine oxidase, beta subunit family (TIGR01373; HMM-score: 17.8)
    Metabolism Energy metabolism Amino acids and amines sarcosine oxidase, monomeric form (TIGR01377; HMM-score: 17.7)
    Metabolism Energy metabolism Electron transport flavocytochrome c (TIGR01813; HMM-score: 16.8)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Chlorophyll and bacteriochlorphyll geranylgeranyl reductase (TIGR02023; EC 1.3.1.-; HMM-score: 15)
    Metabolism Amino acid biosynthesis Pyruvate family ketol-acid reductoisomerase (TIGR00465; EC 1.1.1.86; HMM-score: 14.6)
    glutamate synthase, small subunit (TIGR01318; HMM-score: 14.2)
    putative alkyl hydroperoxide reductase F subunit (TIGR03143; EC 1.6.4.-; HMM-score: 14.1)
    pyridine nucleotide-disulfide oxidoreductase family protein (TIGR03169; HMM-score: 13.4)
    Genetic information processing Protein synthesis tRNA and rRNA base modification tRNA U-34 5-methylaminomethyl-2-thiouridine biosynthesis protein MnmC, C-terminal domain (TIGR03197; HMM-score: 13.4)
    Metabolism Central intermediary metabolism Nitrogen metabolism nitrite reductase [NAD(P)H], large subunit (TIGR02374; EC 1.7.1.4; HMM-score: 13.2)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Thiamine glycine oxidase ThiO (TIGR02352; EC 1.4.3.19; HMM-score: 12.9)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Other phytoene desaturase (TIGR02734; EC 1.14.99.-; HMM-score: 12.4)
    Metabolism Amino acid biosynthesis Glutamate family glutamate synthase (NADPH), homotetrameric (TIGR01316; EC 1.4.1.13; HMM-score: 12.2)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Menaquinone and ubiquinone ubiquinone biosynthesis hydroxylase, UbiH/UbiF/VisC/COQ6 family (TIGR01988; EC 1.14.13.-; HMM-score: 12.2)
    Metabolism Energy metabolism Electron transport glutathione-disulfide reductase (TIGR01421; EC 1.8.1.7; HMM-score: 11.9)
    glutamate synthase, NADH/NADPH, small subunit (TIGR01317; EC 1.4.1.-; HMM-score: 11.8)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Heme, porphyrin, and cobalamin protoporphyrinogen oxidase (TIGR00562; EC 1.3.3.4; HMM-score: 11.5)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Pantothenate and coenzyme A 2-dehydropantoate 2-reductase (TIGR00745; EC 1.1.1.-; HMM-score: 11.5)
    Genetic information processing Protein synthesis tRNA and rRNA base modification tRNA:m(5)U-54 methyltransferase (TIGR00137; EC 2.1.1.74; HMM-score: 11.1)
    9,9'-di-cis-zeta-carotene desaturase (TIGR02732; EC 1.3.5.6; HMM-score: 11.1)
    Metabolism Energy metabolism Anaerobic glycerol-3-phosphate dehydrogenase, anaerobic, B subunit (TIGR03378; EC 1.1.5.3; HMM-score: 9.5)
  • TheSEED:  
    FIG016210: probable monooxygenase
  • PFAM:
    NADP_Rossmann (CL0063) Pyr_redox_3; Pyridine nucleotide-disulphide oxidoreductase (PF13738; HMM-score: 324.8)
    and 14 more
    Pyr_redox_2; Pyridine nucleotide-disulphide oxidoreductase (PF07992; HMM-score: 58.9)
    HI0933_like; HI0933-like protein (PF03486; HMM-score: 30.2)
    GIDA; Glucose inhibited division protein A (PF01134; HMM-score: 29.6)
    DAO; FAD dependent oxidoreductase (PF01266; HMM-score: 29.4)
    FAD_binding_2; FAD binding domain (PF00890; HMM-score: 27.5)
    K_oxygenase; L-lysine 6-monooxygenase (NADPH-requiring) (PF13434; HMM-score: 24.5)
    NAD_binding_8; NAD(P)-binding Rossmann-like domain (PF13450; HMM-score: 21.2)
    NAD_binding_9; FAD-NAD(P)-binding (PF13454; HMM-score: 20.4)
    Thi4; Thi4 family (PF01946; HMM-score: 19.7)
    Pyr_redox; Pyridine nucleotide-disulphide oxidoreductase (PF00070; HMM-score: 19.4)
    IlvN; Acetohydroxy acid isomeroreductase, NADPH-binding domain (PF07991; HMM-score: 17.4)
    NAD_binding_7; Putative NAD(P)-binding (PF13241; HMM-score: 14.5)
    FAD_binding_3; FAD binding domain (PF01494; HMM-score: 13.9)
    FAD_oxidored; FAD dependent oxidoreductase (PF12831; HMM-score: 11.4)

Structure, modifications & interactions[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 0.83
    • Signal peptide possibility: -0.5
    • N-terminally Anchored Score: -1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.136286
    • TAT(Tat/SPI): 0.003412
    • LIPO(Sec/SPII): 0.035827
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

Protein sequence[edit | edit source]

  • MQHHKVAIIGAGAAGIGMAITLKDFGITDVIILEKGTVGHSFKHWPKSTRTITPSFTSNGFGMPDMNAISMDTSPAFTFNEEHISGETYAEYLQVVANHYELNIFENTVVTNISVDDAYYTIATTTEIYHADYIFVATGDYNFPKKPFKYGIHYSEIEDFDNFNKGQYVVIGGNESGFDAAYQLAKNGSDIALYTSTTGLNDPDADPSVRLSPYTRQRLGNVIKQGARIEMNVHYTVKDIDFNNGQYHISFDSGQSVLTPHEPILATGFDATKNPIVQQLFVTTNQDIKLTTHDESTRYPNIFMIGATVENDNAKLCYIYKFRARFAVLAHLLTQREGLPAKQDVIENYQKNQMYLDDYSCCEVSCTC

Experimental data[edit | edit source]

  • experimentally validated: no data available

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator: Zur* (repression) regulon
    Zur(TF)important in Zinc homeostasis; RegPrecise  

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

  1. Ulrike Mäder, Pierre Nicolas, Maren Depke, Jan Pané-Farré, Michel Debarbouille, Magdalena M van der Kooi-Pol, Cyprien Guérin, Sandra Dérozier, Aurelia Hiron, Hanne Jarmer, Aurélie Leduc, Stephan Michalik, Ewoud Reilman, Marc Schaffer, Frank Schmidt, Philippe Bessières, Philippe Noirot, Michael Hecker, Tarek Msadek, Uwe Völker, Jan Maarten van Dijl
    Staphylococcus aureus Transcriptome Architecture: From Laboratory to Infection-Mimicking Conditions.
    PLoS Genet: 2016, 12(4);e1005962
    [PubMed:27035918] [WorldCat.org] [DOI] (I e)

Relevant publications[edit | edit source]