From AureoWiki
Jump to navigation Jump to search
Pangenome04-0298108BA0217611819-97685071193COLECT-R 2ED133ED98HO 5096 0412JH1JH9JKD6008JKD6159LGA251M013MRSA252MSHR1132MSSA476MW2Mu3Mu50N315NCTC8325NewmanRF122ST398T0131TCH60TW20USA300_FPR3757USA300_TCH1516VC40

NCBI: 10-JUN-2013

Summary[edit | edit source]

  • organism: Staphylococcus aureus USA300_FPR3757
  • locus tag: SAUSA300_0078 [new locus tag: SAUSA300_RS00395 ]
  • pan locus tag?: SAUPAN000827000
  • symbol: copA
  • pan gene symbol?: copA
  • synonym:
  • product: ATPase copper transport

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SAUSA300_0078 [new locus tag: SAUSA300_RS00395 ]
  • symbol: copA
  • product: ATPase copper transport
  • replicon: chromosome
  • strand: +
  • coordinates: 86094..88118
  • length: 2025
  • essential: unknown

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    1381
    1441
    1501
    1561
    1621
    1681
    1741
    1801
    1861
    1921
    1981
    ATGAATCATTCCAATCAAATGCATCATGATAACCATGCCTCACATGATCATCATAGTGGC
    CATGCACATCATCATGGAAATTTTAAAGTTAAGTTTTTTGTTTCATTAATTTTTGCAATA
    CCTATCATTCTTTTATCGCCACTGATGGGTGTTAACTTACCTTTTCAATTCACATTTCCA
    GGTTCTGAATGGGTAGTGTTAATATTAAGTACAATTTTATTCTTTTATGGTGGTAAACCG
    TTCTTGTCTGGTGGTAAAGATGAAATTGCTACAAAAAAACCAGGCATGATGACCTTAGTT
    GCCCTAGGTATTTCAGTAGCTTATATTTATAGCTTGTATGCTTTTTATATGAATAACTTT
    AGTAGTGCAACTGGTCATACAATGGACTTTTTTTGGGAATTAGCAACCTTAATTTTAATT
    ATGCTATTAGGACATTGGATAGAAATGAATGCTGTCGGAAATGCTGGAGATGCTTTAAAG
    AAAATGGCAGAACTGTTACCTAATAGTGCTATTAAAGTTATGGATAATGGCCAACGCGAA
    GAAGTTAAAATATCAGACATCATGACTGATGATATCGTCGAAGTAAAAGCCGGAGAAAGC
    ATTCCAACAGATGGTATTATCGTTCAAGGACAAACATCTATAGATGAATCCCTAGTCACT
    GGAGAATCTAAAAAAGTACAAAAAAATCAAAATGACAACGTCATCGGGGGTTCTATTAAT
    GGGTCTGGAACAATACAAGTCAAGGTTACAGCTGTGGGAGAAGATGGATATCTTTCTCAA
    GTTATGGGACTTGTTAATCAAGCACAAAATGATAAATCTAGTGCTGAATTGTTATCTGAT
    AAAGTAGCGGGTTATTTATTCTACTTTGCTGTAAGTGTTGGCGTGATTTCTTTTATTGTC
    TGGATGCTCATTCAAAATGATGTTGATTTTGCATTAGAACGTCTTGTAACTGTGTTAGTC
    ATTGCTTGTCCACATGCTTTAGGCTTGGCAATACCTTTAGTCACTGCACGTTCTACTTCA
    ATTGGTGCACATAATGGTTTAATTATTAAAAATAGAGAGTCTGTAGAAATAGCTCAACAT
    ATCGATTATGTAATGATGGACAAAACTGGTACTTTAACTGAGGGTAACTTTTCTGTGAAT
    CATTATGAGAGCTTTAAAAATGATTTGAGTAATGATACAATATTAAGCCTTTTCGCCTCA
    TTAGAAAGTCAATCTAATCACCCATTAGCTATAAGTATTGTTGATTTTGCGAAAAGTAAA
    AATGTTTCATTTACTAACCCACAAGACGTTAATAATATTCCAGGTGTCGGATTAGAAGGT
    CTAATTGATAATAAAACATATAAAATAACAAATGTCTCTTATCTTGATAAACATAAACTT
    AATTATGACGATGACTTGTTTACTAAATTAGCTCAACAAGGTAATTCAATCAGTTATTTA
    ATTGAGGATCAACAAGTCATTGGCATGATTGCTCAAGGAGATCAAATTAAAGAAAGCTCA
    AAACAAATGGTAGCTGATTTACTATCAAGAAATATTACACCAGTCATGCTTACAGGTGAC
    AATAATGAAGTGGCACACGCTGTCGCAAAAGAATTAGGTATTAGTGATGTCCACGCACAA
    CTCATGCCAGAAGATAAGGAAAGCATTATAAAAGATTATCAAAGTGACGGTAATAAAGTC
    ATGATGGTCGGAGACGGTATCAACGATGCGCCGAGTCTTATAAGAGCGGATATTGGTATA
    GCAATTGGTGCAGGTACAGATGTTGCAGTGGATTCAGGTGATATCATACTTGTTAAAAGT
    AATCCATCAGATATCATTCATTTCTTGACCCTTTCAAATAATACTATGAGAAAAATGGTG
    CAAAACTTATGGTGGGGTGCAGGTTATAATATTGTTGCTGTACCTTTAGCAGCTGGTATT
    TTAGCATTTATTGGCTTGATTTTATCACCTGCAATAGGTGCTATTTTAATGTCTTTAAGT
    ACAATTATCGTTGCAATTAATGCCTTTACATTAAAATTAAAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380
    1440
    1500
    1560
    1620
    1680
    1740
    1800
    1860
    1920
    1980
    2025

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SAUSA300_0078 [new locus tag: SAUSA300_RS00395 ]
  • symbol: CopA
  • description: ATPase copper transport
  • length: 674
  • theoretical pI: 5.19441
  • theoretical MW: 73166.5
  • GRAVY: 0.170178

Function[edit | edit source]

  • reaction:
    EC 3.6.3.4?  ExPASy
    Cu2+-exporting ATPase ATP + H2O + Cu2+(Side 1) = ADP + phosphate + Cu2+(Side 2)
  • TIGRFAM:
    Cellular processes Cellular processes Detoxification copper-translocating P-type ATPase (TIGR01511; EC 3.6.3.4; HMM-score: 609.5)
    Metabolism Transport and binding proteins Cations and iron carrying compounds copper-translocating P-type ATPase (TIGR01511; EC 3.6.3.4; HMM-score: 609.5)
    heavy metal translocating P-type ATPase (TIGR01525; EC 3.6.3.-; HMM-score: 578.1)
    and 15 more
    Metabolism Transport and binding proteins Cations and iron carrying compounds cadmium-translocating P-type ATPase (TIGR01512; EC 3.6.3.3; HMM-score: 369.2)
    HAD ATPase, P-type, family IC (TIGR01494; EC 3.6.3.-; HMM-score: 288.2)
    Metabolism Transport and binding proteins Cations and iron carrying compounds K+-transporting ATPase, B subunit (TIGR01497; EC 3.6.3.12; HMM-score: 183.5)
    plasma-membrane proton-efflux P-type ATPase (TIGR01647; EC 3.6.3.6; HMM-score: 176.5)
    calcium-translocating P-type ATPase, PMCA-type (TIGR01517; EC 3.6.3.8; HMM-score: 145.4)
    Metabolism Transport and binding proteins Cations and iron carrying compounds magnesium-translocating P-type ATPase (TIGR01524; EC 3.6.3.2; HMM-score: 111.8)
    P-type ATPase of unknown pump specificity (type V) (TIGR01657; HMM-score: 109.2)
    calcium-transporting P-type ATPase, PMR1-type (TIGR01522; EC 3.6.3.8; HMM-score: 107.2)
    Metabolism Transport and binding proteins Cations and iron carrying compounds calcium-translocating P-type ATPase, SERCA-type (TIGR01116; EC 3.6.3.8; HMM-score: 102)
    Metabolism Energy metabolism ATP-proton motive force interconversion Na,H/K antiporter P-type ATPase, alpha subunit (TIGR01106; EC 3.6.3.-; HMM-score: 91.2)
    potassium/sodium efflux P-type ATPase, fungal-type (TIGR01523; EC 3.6.3.-; HMM-score: 72)
    Unknown function Enzymes of unknown specificity Cof-like hydrolase (TIGR00099; HMM-score: 21.7)
    Metabolism Amino acid biosynthesis Serine family phosphoserine phosphatase SerB (TIGR00338; EC 3.1.3.3; HMM-score: 21.5)
    phosphoglycolate phosphatase, TA0175-type (TIGR01487; EC 3.1.3.18; HMM-score: 18.4)
    phospholipid-translocating P-type ATPase, flippase (TIGR01652; EC 3.6.3.1; HMM-score: 15.7)
  • TheSEED:  
    Protein Metabolism Protein biosynthesis Prolyl-tRNA synthetase associated editing enzymes  Cu+ P-type ATPase
    and 3 more
    Respiration Electron accepting reactions Terminal cytochrome C oxidases  Copper-translocating P-type ATPase (EC 3.6.3.4)
    Virulence, Disease and Defense Resistance to antibiotics and toxic compounds Copper homeostasis  Copper-translocating P-type ATPase (EC 3.6.3.4)
    CBSS-196620.1.peg.2477  Copper-translocating P-type ATPase (EC 3.6.3.4)
  • PFAM:
    no clan defined E1-E2_ATPase; E1-E2 ATPase (PF00122; HMM-score: 164.7)
    and 3 more
    HAD (CL0137) Hydrolase; haloacid dehalogenase-like hydrolase (PF00702; HMM-score: 120.7)
    Hydrolase_3; haloacid dehalogenase-like hydrolase (PF08282; HMM-score: 18.8)
    no clan defined DUF1980; Domain of unknown function (DUF1980) (PF09323; HMM-score: 7.6)

Structure, modifications & interactions[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic Membrane
    • Cytoplasmic Score: 0
    • Cytoplasmic Membrane Score: 9.99
    • Cellwall Score: 0.01
    • Extracellular Score: 0.01
    • Internal Helices: 8
  • LocateP: Multi-transmembrane
    • Prediction by SwissProt Classification: Membrane
    • Pathway Prediction: Sec-(SPI)
    • Intracellular possibility: 0.17
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.025744
    • TAT(Tat/SPI): 0.000772
    • LIPO(Sec/SPII): 0.006018
  • predicted transmembrane helices (TMHMM): 8

Accession numbers[edit | edit source]

Protein sequence[edit | edit source]

  • MNHSNQMHHDNHASHDHHSGHAHHHGNFKVKFFVSLIFAIPIILLSPLMGVNLPFQFTFPGSEWVVLILSTILFFYGGKPFLSGGKDEIATKKPGMMTLVALGISVAYIYSLYAFYMNNFSSATGHTMDFFWELATLILIMLLGHWIEMNAVGNAGDALKKMAELLPNSAIKVMDNGQREEVKISDIMTDDIVEVKAGESIPTDGIIVQGQTSIDESLVTGESKKVQKNQNDNVIGGSINGSGTIQVKVTAVGEDGYLSQVMGLVNQAQNDKSSAELLSDKVAGYLFYFAVSVGVISFIVWMLIQNDVDFALERLVTVLVIACPHALGLAIPLVTARSTSIGAHNGLIIKNRESVEIAQHIDYVMMDKTGTLTEGNFSVNHYESFKNDLSNDTILSLFASLESQSNHPLAISIVDFAKSKNVSFTNPQDVNNIPGVGLEGLIDNKTYKITNVSYLDKHKLNYDDDLFTKLAQQGNSISYLIEDQQVIGMIAQGDQIKESSKQMVADLLSRNITPVMLTGDNNEVAHAVAKELGISDVHAQLMPEDKESIIKDYQSDGNKVMMVGDGINDAPSLIRADIGIAIGAGTDVAVDSGDIILVKSNPSDIIHFLTLSNNTMRKMVQNLWWGAGYNIVAVPLAAGILAFIGLILSPAIGAILMSLSTIIVAINAFTLKLK

Experimental data[edit | edit source]

  • experimentally validated: no data available

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

Relevant publications[edit | edit source]