From AureoWiki
Jump to navigation Jump to search

NCBI: 10-JUN-2013

Summary[edit | edit source]

  • organism: Staphylococcus aureus USA300_FPR3757
  • locus tag: SAUSA300_0221 [new locus tag: SAUSA300_RS01160 ]
  • pan locus tag?: SAUPAN001083000
  • symbol: pflA
  • pan gene symbol?: pflA
  • synonym:
  • product: pyruvate formate-lyase activating enzyme

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SAUSA300_0221 [new locus tag: SAUSA300_RS01160 ]
  • symbol: pflA
  • product: pyruvate formate-lyase activating enzyme
  • replicon: chromosome
  • strand: +
  • coordinates: 262851..263606
  • length: 756
  • essential: unknown other strains

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    ATGCTTAAGGGACACTTACATTCTGTCGAAAGTTTAGGTACTGTCGATGGACCGGGATTA
    AGATATATATTATTTACACAAGGATGCTTACTTAGATGCTTGTATTGCCACAATCCAGAT
    ACTTGGAAAATTAGTGAGCCATCAAGAGAAGTCACAGTTGATGAAATGGTGAATGAAATA
    TTACCATACAAACCATACTTTGATGCATCGGGTGGCGGTGTAACAGTCAGTGGTGGCGAA
    CCATTGTTACAAATGCCATTCTTAGAAAAATTATTTGCAGAATTAAAAGAAAATGGTGTG
    CACACTTGCTTAGACACATCGGCTGGATGTGCTAATGATACAAAAGCATTTCAAAGGCAT
    TTTGAAGAATTACAAAAACATACAGACTTGATATTATTAGATATAAAACATATTGATAAT
    GACAAACATATTAGATTGACAGGAAAGCCTAATACACACATCCTTAACTTCGCGCGCAAA
    CTGTCAGATATGAAACAACCTGTATGGATTCGACATGTCCTTGTGCCTGGTTATTCTGAT
    GATAAAGACGATTTAATTAAACTAGGGGAATTTATTAATTCTCTTGATAACGTCGAAAAG
    TTTGAAATTCTGCCATATCATCAGTTAGGTGTTCATAAGTGGAAAACATTGGGCATTGCA
    TATGAATTAGAAGATGTCGAAGCGCCCGATGATGAAGCTGTTAAAGCAGCCTACCGTTAT
    GTTAACTTCAAAGGGAAAATTCCCGTTGAATTATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    756

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SAUSA300_0221 [new locus tag: SAUSA300_RS01160 ]
  • symbol: PflA
  • description: pyruvate formate-lyase activating enzyme
  • length: 251
  • theoretical pI: 5.9116
  • theoretical MW: 28498.4
  • GRAVY: -0.319124

Function[edit | edit source]

  • reaction:
    EC 1.97.1.4?  ExPASy
    [Formate-C-acetyltransferase]-activating enzyme S-adenosyl-L-methionine + dihydroflavodoxin + [formate C-acetyltransferase]-glycine = 5'-deoxyadenosine + L-methionine + flavodoxin semiquinone + [formate C-acetyltransferase]-glycin-2-yl radical
  • TIGRFAM:
    Genetic information processing Protein fate Protein modification and repair pyruvate formate-lyase 1-activating enzyme (TIGR02493; EC 1.97.1.4; HMM-score: 320.7)
    Metabolism Energy metabolism Anaerobic pyruvate formate-lyase 1-activating enzyme (TIGR02493; EC 1.97.1.4; HMM-score: 320.7)
    and 30 more
    glycyl-radical enzyme activating protein (TIGR02494; EC 1.97.1.-; HMM-score: 195.8)
    Metabolism Energy metabolism Amino acids and amines choline TMA-lyase-activating enzyme (TIGR04395; EC 1.97.-.-; HMM-score: 154.8)
    Genetic information processing Protein fate Protein modification and repair glycine radical enzyme activase, YjjW family (TIGR04041; EC 1.97.1.-; HMM-score: 133.4)
    Genetic information processing Protein fate Protein modification and repair [benzylsuccinate synthase]-activating enzyme (TIGR04003; EC 1.97.-.-; HMM-score: 127.2)
    Genetic information processing Protein fate Protein modification and repair anaerobic ribonucleoside-triphosphate reductase activating protein (TIGR02495; EC 1.97.-.-; HMM-score: 64.4)
    Metabolism Purines, pyrimidines, nucleosides, and nucleotides 2'-Deoxyribonucleotide metabolism anaerobic ribonucleoside-triphosphate reductase activating protein (TIGR02495; EC 1.97.-.-; HMM-score: 64.4)
    Genetic information processing Protein fate Protein modification and repair anaerobic ribonucleoside-triphosphate reductase activating protein (TIGR02491; EC 1.97.1.-; HMM-score: 55)
    Metabolism Purines, pyrimidines, nucleosides, and nucleotides 2'-Deoxyribonucleotide metabolism anaerobic ribonucleoside-triphosphate reductase activating protein (TIGR02491; EC 1.97.1.-; HMM-score: 55)
    His-Xaa-Ser system radical SAM maturase HxsC (TIGR03977; HMM-score: 33.6)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Other coenzyme PQQ biosynthesis enzyme PqqE (TIGR02109; HMM-score: 30)
    putative 7-cyano-7-deazaguanosine (preQ0) biosynthesis protein QueE (TIGR04349; HMM-score: 29.3)
    radical SAM protein, TatD family-associated (TIGR04038; HMM-score: 29.1)
    Genetic information processing Protein synthesis tRNA and rRNA base modification 7-cyano-7-deazaguanosine (preQ0) biosynthesis protein QueE (TIGR03365; HMM-score: 25.7)
    Genetic information processing Protein synthesis tRNA and rRNA base modification putative 7-cyano-7-deazaguanosine (preQ0) biosynthesis protein QueE (TIGR03963; HMM-score: 25.6)
    Metabolism Purines, pyrimidines, nucleosides, and nucleotides 2'-Deoxyribonucleotide metabolism anaerobic ribonucleoside-triphosphate reductase activating protein (TIGR02826; EC 1.97.1.-; HMM-score: 25)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Molybdopterin molybdenum cofactor biosynthesis protein A (TIGR02666; HMM-score: 24.2)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Molybdopterin probable molybdenum cofactor biosynthesis protein A (TIGR02668; HMM-score: 22.1)
    AmmeMemoRadiSam system radical SAM enzyme (TIGR04337; HMM-score: 21.9)
    putative 7-cyano-7-deazaguanosine (preQ0) biosynthesis protein QueE (TIGR04322; HMM-score: 17.1)
    SynChlorMet cassette radical SAM/SPASM protein ScmF (TIGR04251; HMM-score: 16.5)
    putative peptide-modifying radical SAM enzyme, Mhun_1560 family (TIGR04083; HMM-score: 15.6)
    Signal transduction Regulatory functions Protein interactions peptide modification radical SAM enzyme, YydG family (TIGR04078; HMM-score: 14.9)
    Cellular processes Cellular processes Toxin production and resistance Cys-rich peptide radical SAM maturase CcpM (TIGR04068; HMM-score: 14.6)
    radical SAM peptide maturase, GG-Bacteroidales family (TIGR04148; HMM-score: 14.6)
    putative geopeptide radical SAM maturase (TIGR04280; HMM-score: 14.1)
    radical SAM peptide maturase, CXXX-repeat target family (TIGR04115; HMM-score: 13.4)
    Cellular processes Cellular processes Toxin production and resistance tryptophan 2-C-methyltransferase (TIGR04428; EC 2.1.1.106; HMM-score: 12.1)
    SynChlorMet cassette radical SAM/SPASM protein ScmE (TIGR04250; HMM-score: 12)
    His-Xaa-Ser system radical SAM maturase HxsB (TIGR03978; HMM-score: 10.5)
    Cellular processes Cellular processes Toxin production and resistance nif11-like peptide radical SAM maturase (TIGR04064; HMM-score: 9.6)
  • TheSEED:  
    Carbohydrates Fermentation Fermentations: Mixed acid  Pyruvate formate-lyase activating enzyme (EC 1.97.1.4)
    and 1 more
    Respiration Respiration - no subcategory Formate hydrogenase  Pyruvate formate-lyase activating enzyme (EC 1.97.1.4)
  • PFAM:
    TIM_barrel (CL0036) Radical_SAM; Radical SAM superfamily (PF04055; HMM-score: 94.8)
    and 2 more
    4Fe-4S (CL0344) Fer4_12; 4Fe-4S single cluster domain (PF13353; HMM-score: 65.2)
    Fer4_14; 4Fe-4S single cluster domain (PF13394; HMM-score: 36.5)

Structure, modifications & interactions[edit | edit source]

  • domains:
  • modifications:
  • cofactors: [4Fe-4S] cluster
  • effectors:
  • protein partners:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 1
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.04507
    • TAT(Tat/SPI): 0.001294
    • LIPO(Sec/SPII): 0.124692
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

Protein sequence[edit | edit source]

  • MLKGHLHSVESLGTVDGPGLRYILFTQGCLLRCLYCHNPDTWKISEPSREVTVDEMVNEILPYKPYFDASGGGVTVSGGEPLLQMPFLEKLFAELKENGVHTCLDTSAGCANDTKAFQRHFEELQKHTDLILLDIKHIDNDKHIRLTGKPNTHILNFARKLSDMKQPVWIRHVLVPGYSDDKDDLIKLGEFINSLDNVEKFEILPYHQLGVHKWKTLGIAYELEDVEAPDDEAVKAAYRYVNFKGKIPVEL

Experimental data[edit | edit source]

  • experimentally validated: no data available

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulators: CcpA regulon, Rex (repression) regulon
    CcpA(TF)important in Carbon catabolism; RegPrecise    transcription unit transferred from N315 data RegPrecise  
    Rex(TF)important in Energy metabolism; RegPrecise    transcription unit transferred from N315 data RegPrecise  

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

Relevant publications[edit | edit source]