Jump to navigation
Jump to search
NCBI: 03-AUG-2016
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus NCTC8325
- locus tag: SAOUHSC_00188
- pan locus tag?: SAUPAN001083000
- symbol: SAOUHSC_00188
- pan gene symbol?: pflA
- synonym:
- product: pyruvate formate-lyase 1 activating enzyme
⊟Additional information (user-provided)[edit | edit source]
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: SAOUHSC_00188
- symbol: SAOUHSC_00188
- product: pyruvate formate-lyase 1 activating enzyme
- replicon: chromosome
- strand: +
- coordinates: 208180..208935
- length: 756
- essential: no DEG other strains
⊟Accession numbers[edit | edit source]
- Gene ID: 3919502 NCBI
- RefSeq: YP_498785 NCBI
- BioCyc: G1I0R-176 BioCyc
- MicrobesOnline: 1288679 MicrobesOnline
⊟Phenotype[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301
361
421
481
541
601
661
721ATGCTTAAGGGACACTTACATTCTGTCGAAAGTTTAGGTACTGTCGATGGACCGGGATTA
AGATATATATTATTTACACAAGGATGCTTACTTAGATGCTTGTATTGCCACAATCCAGAT
ACTTGGAAAATTAGTGAGCCATCAAGAGAAGTCACAGTTGATGAAATGGTGAATGAAATA
TTACCATACAAACCATACTTTGATGCATCGGGTGGCGGTGTAACAGTCAGTGGTGGCGAA
CCATTGTTACAAATGCCATTCTTAGAAAAATTATTTGCAGAATTAAAAGAAAATGGTGTG
CACACTTGCTTAGACACATCGGCTGGATGTGCTAATGATACAAAAGCATTTCAAAGGCAT
TTTGAAGAATTACAAAAACATACAGACTTGATATTATTAGATATAAAACATATTGATAAT
GACAAACATATTAGATTGACAGGAAAGCCTAATACACACATCCTTAACTTCGCGCGCAAA
CTGTCAGATATGAAACAACCTGTATGGATTCGACATGTCCTTGTGCCTGGTTATTCTGAT
GATAAAGACGATTTAATTAAACTAGGGGAATTTATTAATTCTCTTGATAACGTCGAAAAG
TTTGAAATTCTGCCATATCATCAGTTAGGTGTTCATAAGTGGAAAACATTGGGCATTGCA
TATGAATTAGAAGATGTCGAAGCGCCCGATGATGAAGCTGTTAAAGCAGCCTACCGTTAT
GTTAACTTCAAAGGGAAAATTCCCGTTGAATTATAA60
120
180
240
300
360
420
480
540
600
660
720
756
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: SAOUHSC_00188
- symbol: SAOUHSC_00188
- description: pyruvate formate-lyase 1 activating enzyme
- length: 251
- theoretical pI: 5.9116
- theoretical MW: 28498.4
- GRAVY: -0.319124
⊟Function[edit | edit source]
- reaction: EC 1.97.1.4? ExPASy[Formate-C-acetyltransferase]-activating enzyme S-adenosyl-L-methionine + dihydroflavodoxin + [formate C-acetyltransferase]-glycine = 5'-deoxyadenosine + L-methionine + flavodoxin semiquinone + [formate C-acetyltransferase]-glycin-2-yl radical
- TIGRFAM: Protein fate Protein modification and repair pyruvate formate-lyase 1-activating enzyme (TIGR02493; EC 1.97.1.4; HMM-score: 320.7)Energy metabolism Anaerobic pyruvate formate-lyase 1-activating enzyme (TIGR02493; EC 1.97.1.4; HMM-score: 320.7)and 30 moreglycyl-radical enzyme activating protein (TIGR02494; EC 1.97.1.-; HMM-score: 195.8)Energy metabolism Amino acids and amines choline TMA-lyase-activating enzyme (TIGR04395; EC 1.97.-.-; HMM-score: 154.8)Protein fate Protein modification and repair glycine radical enzyme activase, YjjW family (TIGR04041; EC 1.97.1.-; HMM-score: 133.4)Protein fate Protein modification and repair [benzylsuccinate synthase]-activating enzyme (TIGR04003; EC 1.97.-.-; HMM-score: 127.2)Protein fate Protein modification and repair anaerobic ribonucleoside-triphosphate reductase activating protein (TIGR02495; EC 1.97.-.-; HMM-score: 64.4)Purines, pyrimidines, nucleosides, and nucleotides 2'-Deoxyribonucleotide metabolism anaerobic ribonucleoside-triphosphate reductase activating protein (TIGR02495; EC 1.97.-.-; HMM-score: 64.4)Protein fate Protein modification and repair anaerobic ribonucleoside-triphosphate reductase activating protein (TIGR02491; EC 1.97.1.-; HMM-score: 55)Purines, pyrimidines, nucleosides, and nucleotides 2'-Deoxyribonucleotide metabolism anaerobic ribonucleoside-triphosphate reductase activating protein (TIGR02491; EC 1.97.1.-; HMM-score: 55)His-Xaa-Ser system radical SAM maturase HxsC (TIGR03977; HMM-score: 33.6)Biosynthesis of cofactors, prosthetic groups, and carriers Other coenzyme PQQ biosynthesis enzyme PqqE (TIGR02109; HMM-score: 30)putative 7-cyano-7-deazaguanosine (preQ0) biosynthesis protein QueE (TIGR04349; HMM-score: 29.3)radical SAM protein, TatD family-associated (TIGR04038; HMM-score: 29.1)Protein synthesis tRNA and rRNA base modification 7-cyano-7-deazaguanosine (preQ0) biosynthesis protein QueE (TIGR03365; HMM-score: 25.7)Protein synthesis tRNA and rRNA base modification putative 7-cyano-7-deazaguanosine (preQ0) biosynthesis protein QueE (TIGR03963; HMM-score: 25.6)Purines, pyrimidines, nucleosides, and nucleotides 2'-Deoxyribonucleotide metabolism anaerobic ribonucleoside-triphosphate reductase activating protein (TIGR02826; EC 1.97.1.-; HMM-score: 25)Biosynthesis of cofactors, prosthetic groups, and carriers Molybdopterin molybdenum cofactor biosynthesis protein A (TIGR02666; HMM-score: 24.2)Biosynthesis of cofactors, prosthetic groups, and carriers Molybdopterin probable molybdenum cofactor biosynthesis protein A (TIGR02668; HMM-score: 22.1)AmmeMemoRadiSam system radical SAM enzyme (TIGR04337; HMM-score: 21.9)putative 7-cyano-7-deazaguanosine (preQ0) biosynthesis protein QueE (TIGR04322; HMM-score: 17.1)SynChlorMet cassette radical SAM/SPASM protein ScmF (TIGR04251; HMM-score: 16.5)putative peptide-modifying radical SAM enzyme, Mhun_1560 family (TIGR04083; HMM-score: 15.6)Regulatory functions Protein interactions peptide modification radical SAM enzyme, YydG family (TIGR04078; HMM-score: 14.9)Cellular processes Toxin production and resistance Cys-rich peptide radical SAM maturase CcpM (TIGR04068; HMM-score: 14.6)radical SAM peptide maturase, GG-Bacteroidales family (TIGR04148; HMM-score: 14.6)putative geopeptide radical SAM maturase (TIGR04280; HMM-score: 14.1)radical SAM peptide maturase, CXXX-repeat target family (TIGR04115; HMM-score: 13.4)Cellular processes Toxin production and resistance tryptophan 2-C-methyltransferase (TIGR04428; EC 2.1.1.106; HMM-score: 12.1)SynChlorMet cassette radical SAM/SPASM protein ScmE (TIGR04250; HMM-score: 12)His-Xaa-Ser system radical SAM maturase HxsB (TIGR03978; HMM-score: 10.5)Cellular processes Toxin production and resistance nif11-like peptide radical SAM maturase (TIGR04064; HMM-score: 9.6)
- TheSEED :
- Pyruvate formate-lyase activating enzyme (EC 1.97.1.4)
Carbohydrates Fermentation Fermentations: Mixed acid Pyruvate formate-lyase activating enzyme (EC 1.97.1.4)and 1 more - PFAM: TIM_barrel (CL0036) Radical_SAM; Radical SAM superfamily (PF04055; HMM-score: 86.6)and 1 more4Fe-4S (CL0344) Fer4_12; 4Fe-4S single cluster domain (PF13353; HMM-score: 62)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors: [4Fe-4S] cluster
- effectors:
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic
- Cytoplasmic Score: 9.97
- Cytoplasmic Membrane Score: 0
- Cellwall Score: 0.01
- Extracellular Score: 0.02
- Internal Helices: 0
- DeepLocPro: Cytoplasmic
- Cytoplasmic Score: 0.9864
- Cytoplasmic Membrane Score: 0.0056
- Cell wall & surface Score: 0.0001
- Extracellular Score: 0.008
- LocateP: Intracellular
- Prediction by SwissProt Classification: Cytoplasmic
- Pathway Prediction: No pathway
- Intracellular possibility: 1
- Signal peptide possibility: -1
- N-terminally Anchored Score: 1
- Predicted Cleavage Site: No CleavageSite
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.04507
- TAT(Tat/SPI): 0.001294
- LIPO(Sec/SPII): 0.124692
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Protein sequence[edit | edit source]
- MLKGHLHSVESLGTVDGPGLRYILFTQGCLLRCLYCHNPDTWKISEPSREVTVDEMVNEILPYKPYFDASGGGVTVSGGEPLLQMPFLEKLFAELKENGVHTCLDTSAGCANDTKAFQRHFEELQKHTDLILLDIKHIDNDKHIRLTGKPNTHILNFARKLSDMKQPVWIRHVLVPGYSDDKDDLIKLGEFINSLDNVEKFEILPYHQLGVHKWKTLGIAYELEDVEAPDDEAVKAAYRYVNFKGKIPVEL
⊟Experimental data[edit | edit source]
- experimentally validated: PeptideAtlas [1] [2]
- protein localization:
- quantitative data / protein copy number per cell:
- interaction partners:
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
⊟Regulation[edit | edit source]
- regulators: CcpA* regulon, Rex* (repression) regulon
CcpA* (TF) important in Carbon catabolism; RegPrecise transcription unit transferred from N315 data RegPrecise Rex* (TF) important in Energy metabolism; RegPrecise transcription unit transferred from N315 data RegPrecise
⊟Additional information (user-provided)[edit | edit source]
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: [3]
Multi-gene expression profiles
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
- Aureolib: no data available
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Other information (user-provided)[edit | edit source]
You can add further information about the gene and protein here. [edit]
⊟Literature[edit | edit source]
⊟References[edit | edit source]
- ↑ Maren Depke, Stephan Michalik, Alexander Rabe, Kristin Surmann, Lars Brinkmann, Nico Jehmlich, Jörg Bernhardt, Michael Hecker, Bernd Wollscheid, Zhi Sun, Robert L Moritz, Uwe Völker, Frank Schmidt
A peptide resource for the analysis of Staphylococcus aureus in host-pathogen interaction studies.
Proteomics: 2015, 15(21);3648-61
[PubMed:26224020] [WorldCat.org] [DOI] (I p) - ↑ Stephan Michalik, Maren Depke, Annette Murr, Manuela Gesell Salazar, Ulrike Kusebauch, Zhi Sun, Tanja C Meyer, Kristin Surmann, Henrike Pförtner, Petra Hildebrandt, Stefan Weiss, Laura Marcela Palma Medina, Melanie Gutjahr, Elke Hammer, Dörte Becher, Thomas Pribyl, Sven Hammerschmidt, Eric W Deutsch, Samuel L Bader, Michael Hecker, Robert L Moritz, Ulrike Mäder, Uwe Völker, Frank Schmidt
A global Staphylococcus aureus proteome resource applied to the in vivo characterization of host-pathogen interactions.
Sci Rep: 2017, 7(1);9718
[PubMed:28887440] [WorldCat.org] [DOI] (I e) - ↑ 3.0 3.1 Ulrike Mäder, Pierre Nicolas, Maren Depke, Jan Pané-Farré, Michel Debarbouille, Magdalena M van der Kooi-Pol, Cyprien Guérin, Sandra Dérozier, Aurelia Hiron, Hanne Jarmer, Aurélie Leduc, Stephan Michalik, Ewoud Reilman, Marc Schaffer, Frank Schmidt, Philippe Bessières, Philippe Noirot, Michael Hecker, Tarek Msadek, Uwe Völker, Jan Maarten van Dijl
Staphylococcus aureus Transcriptome Architecture: From Laboratory to Infection-Mimicking Conditions.
PLoS Genet: 2016, 12(4);e1005962
[PubMed:27035918] [WorldCat.org] [DOI] (I e)
