Jump to navigation
Jump to search
NCBI: 01-DEC-2025
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus JSNZ
- locus tag: EGJ38_000163 [new locus tag: EGJ38_RS00820 ]
- pan locus tag?: SAUPAN001083000
- symbol: pflA
- pan gene symbol?: pflA
- synonym:
- alternate name: JSNZ_000163
- product: pyruvate formate-lyase-activating protein
⊟Additional information (user-provided)[edit | edit source]
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: EGJ38_000163 [new locus tag: EGJ38_RS00820 ]
- symbol: pflA
- product: pyruvate formate-lyase-activating protein
- replicon: chromosome
- strand: +
- coordinates: 197797..198552
- length: 756
- essential: unknown other strains
⊟Accession numbers[edit | edit source]
- Gene ID:
- RefSeq: MGT2422171 NCBI
- BioCyc:
- MicrobesOnline:
⊟Phenotype[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301
361
421
481
541
601
661
721ATGCTTAAGGGACACTTACATTCTGTCGAAAGTTTAGGTACTGTCGATGGACCGGGATTA
AGATATATATTATTTACACAAGGATGCTTACTTAGATGCTTGTATTGCCACAATCCAGAT
ACTTGGAAAATTAGTGAGCCATCAAGAGAAGTCACAGTTGATGAAATGGTGAATGAAATA
TTACCATACAAACCATACTTTGATGCATCGGGTGGCGGTGTAACAGTCAGTGGTGGCGAA
CCATTGTTACAAATGCCATTCTTAGAAAAATTATTTGCGGAATTAAAAGAAAATGGTGTG
CACACTTGCTTAGACACATCGGCTGGATGTGCTAATGATACAAAAGCATTTCAAAGGCAT
TTTGAAGAATTACAAAAACATACAGACTTGATATTATTAGATATAAAACATATTGATAAT
GACAAACATATTAGATTGACAGGAAAGCCTAATACACACATCCTTAACTTCGCGCGCAAA
CTGTCAGATATGAAACAACCTGTATGGATTCGACATGTCCTTGTGCCTGGTTATTCTGAT
GATAAAGACGATTTAATTAAACTAGGGGAATTCATTAATTCTCTTGATAACGTCGAAAAG
TTTGAAATTCTGCCATATCATCAGTTAGGTGTTCATAAGTGGAAAACATTGGGCATTGCA
TATGAATTAGAAGATGTCGAAGCGCCCGATGATGAAGCTGTTAAAGCAGCCTACCGTTAT
GTTAACTTCAAAGGGAAAATTCCCGTTGAATTATAA60
120
180
240
300
360
420
480
540
600
660
720
756
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: EGJ38_000163 [new locus tag: EGJ38_RS00820 ]
- symbol: PflA
- description: pyruvate formate-lyase-activating protein
- length: 251
- theoretical pI: 5.9116
- theoretical MW: 28498.4
- GRAVY: -0.319124
⊟Function[edit | edit source]
- reaction: EC 1.97.1.4? ExPASy[Formate-C-acetyltransferase]-activating enzyme S-adenosyl-L-methionine + dihydroflavodoxin + [formate C-acetyltransferase]-glycine = 5'-deoxyadenosine + L-methionine + flavodoxin semiquinone + [formate C-acetyltransferase]-glycin-2-yl radical
- TIGRFAM: Protein fate Protein modification and repair pyruvate formate-lyase 1-activating enzyme (TIGR02493; EC 1.97.1.4; HMM-score: 320.7)Energy metabolism Anaerobic pyruvate formate-lyase 1-activating enzyme (TIGR02493; EC 1.97.1.4; HMM-score: 320.7)and 30 moreglycyl-radical enzyme activating protein (TIGR02494; EC 1.97.1.-; HMM-score: 195.8)Energy metabolism Amino acids and amines choline TMA-lyase-activating enzyme (TIGR04395; EC 1.97.-.-; HMM-score: 154.8)Protein fate Protein modification and repair glycine radical enzyme activase, YjjW family (TIGR04041; EC 1.97.1.-; HMM-score: 133.4)Protein fate Protein modification and repair [benzylsuccinate synthase]-activating enzyme (TIGR04003; EC 1.97.-.-; HMM-score: 127.2)Protein fate Protein modification and repair anaerobic ribonucleoside-triphosphate reductase activating protein (TIGR02495; EC 1.97.-.-; HMM-score: 64.4)Purines, pyrimidines, nucleosides, and nucleotides 2'-Deoxyribonucleotide metabolism anaerobic ribonucleoside-triphosphate reductase activating protein (TIGR02495; EC 1.97.-.-; HMM-score: 64.4)Protein fate Protein modification and repair anaerobic ribonucleoside-triphosphate reductase activating protein (TIGR02491; EC 1.97.1.-; HMM-score: 55)Purines, pyrimidines, nucleosides, and nucleotides 2'-Deoxyribonucleotide metabolism anaerobic ribonucleoside-triphosphate reductase activating protein (TIGR02491; EC 1.97.1.-; HMM-score: 55)His-Xaa-Ser system radical SAM maturase HxsC (TIGR03977; HMM-score: 33.6)Biosynthesis of cofactors, prosthetic groups, and carriers Other coenzyme PQQ biosynthesis enzyme PqqE (TIGR02109; HMM-score: 30)putative 7-cyano-7-deazaguanosine (preQ0) biosynthesis protein QueE (TIGR04349; HMM-score: 29.3)radical SAM protein, TatD family-associated (TIGR04038; HMM-score: 29.1)Protein synthesis tRNA and rRNA base modification 7-cyano-7-deazaguanosine (preQ0) biosynthesis protein QueE (TIGR03365; HMM-score: 25.7)Protein synthesis tRNA and rRNA base modification putative 7-cyano-7-deazaguanosine (preQ0) biosynthesis protein QueE (TIGR03963; HMM-score: 25.6)Purines, pyrimidines, nucleosides, and nucleotides 2'-Deoxyribonucleotide metabolism anaerobic ribonucleoside-triphosphate reductase activating protein (TIGR02826; EC 1.97.1.-; HMM-score: 25)Biosynthesis of cofactors, prosthetic groups, and carriers Molybdopterin molybdenum cofactor biosynthesis protein A (TIGR02666; HMM-score: 24.2)Biosynthesis of cofactors, prosthetic groups, and carriers Molybdopterin probable molybdenum cofactor biosynthesis protein A (TIGR02668; HMM-score: 22.1)AmmeMemoRadiSam system radical SAM enzyme (TIGR04337; HMM-score: 21.9)putative 7-cyano-7-deazaguanosine (preQ0) biosynthesis protein QueE (TIGR04322; HMM-score: 17.1)SynChlorMet cassette radical SAM/SPASM protein ScmF (TIGR04251; HMM-score: 16.5)putative peptide-modifying radical SAM enzyme, Mhun_1560 family (TIGR04083; HMM-score: 15.6)Regulatory functions Protein interactions peptide modification radical SAM enzyme, YydG family (TIGR04078; HMM-score: 14.9)Cellular processes Toxin production and resistance Cys-rich peptide radical SAM maturase CcpM (TIGR04068; HMM-score: 14.6)radical SAM peptide maturase, GG-Bacteroidales family (TIGR04148; HMM-score: 14.6)putative geopeptide radical SAM maturase (TIGR04280; HMM-score: 14.1)radical SAM peptide maturase, CXXX-repeat target family (TIGR04115; HMM-score: 13.4)Cellular processes Toxin production and resistance tryptophan 2-C-methyltransferase (TIGR04428; EC 2.1.1.106; HMM-score: 12.1)SynChlorMet cassette radical SAM/SPASM protein ScmE (TIGR04250; HMM-score: 12)His-Xaa-Ser system radical SAM maturase HxsB (TIGR03978; HMM-score: 10.5)Cellular processes Toxin production and resistance nif11-like peptide radical SAM maturase (TIGR04064; HMM-score: 9.6)
- TheSEED: data available for COL, N315, NCTC8325, Newman, USA300_FPR3757
- PFAM: TIM_barrel (CL0036) Radical_SAM; Radical SAM superfamily (PF04055; HMM-score: 86.6)and 1 more4Fe-4S (CL0344) Fer4_12; 4Fe-4S single cluster domain (PF13353; HMM-score: 62)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic
- Cytoplasmic Score: 9.97
- Cytoplasmic Membrane Score: 0
- Cellwall Score: 0.01
- Extracellular Score: 0.02
- Internal Helices: 0
- DeepLocPro: Cytoplasmic
- Cytoplasmic Score: 0.9864
- Cytoplasmic Membrane Score: 0.0056
- Cell wall & surface Score: 0.0001
- Extracellular Score: 0.008
- LocateP:
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.04507
- TAT(Tat/SPI): 0.001294
- LIPO(Sec/SPII): 0.124693
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
- GI:
- RefSeq: MGT2422171 NCBI
- UniProt:
⊟Additional information (user-provided)[edit | edit source]
⊟Protein sequence[edit | edit source]
- MLKGHLHSVESLGTVDGPGLRYILFTQGCLLRCLYCHNPDTWKISEPSREVTVDEMVNEILPYKPYFDASGGGVTVSGGEPLLQMPFLEKLFAELKENGVHTCLDTSAGCANDTKAFQRHFEELQKHTDLILLDIKHIDNDKHIRLTGKPNTHILNFARKLSDMKQPVWIRHVLVPGYSDDKDDLIKLGEFINSLDNVEKFEILPYHQLGVHKWKTLGIAYELEDVEAPDDEAVKAAYRYVNFKGKIPVEL
⊟Experimental data[edit | edit source]
- experimentally validated: data available for NCTC8325
- protein localization:
- quantitative data / protein copy number per cell:
- interaction partners:
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
⊟Regulation[edit | edit source]
- regulators: ArcR (activation) regulon, CcpA regulon, Rex (repression) regulon
ArcR (TF) important in Arginine degradation; regulation predicted or transferred from N315 and NCTC 8325 [2] CcpA (TF) important in Carbon catabolism; regulation predicted or transferred from N315 and NCTC 8325 [2] Rex (TF) important in Energy metabolism; regulation predicted or transferred from N315 and NCTC 8325 [2]
⊟Additional information (user-provided)[edit | edit source]
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
- Aureolib: no data available
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Other information (user-provided)[edit | edit source]
You can add further information about the gene and protein here. [edit]
⊟Literature[edit | edit source]
⊟References[edit | edit source]
- ↑ Blanca Taboada, Karel Estrada, Ricardo Ciria, Enrique Merino
Operon-mapper: a web server for precise operon identification in bacterial and archaeal genomes.
Bioinformatics: 2018, 34(23);4118-4120
[PubMed:29931111] [WorldCat.org] [DOI] (I p) - ↑ 2.0 2.1 2.2 Hannes Wolfgramm, Larissa Milena Busch, Jöran Tebben, Henry Mehlan, Lisa Hagenau, Thomas Sura, Tilly Hoffmüller, Elisa Bludau, Manuela Gesell Salazar, Alexander Reder, Stephan Michalik, Leif Steil, Kristin Surmann, Ulrike Mäder, Silva Holtfreter, Uwe Völker
Integrated genomic and proteomic analysis of the mouse-adapted Staphylococcus aureus strain JSNZ.
Curr Res Microb Sci: 2025, 9;100489
[PubMed:41146725] [WorldCat.org] [DOI] (I e)