From AureoWiki
Jump to navigation Jump to search

NCBI: 10-JUN-2013

Summary[edit | edit source]

  • organism: Staphylococcus aureus USA300_FPR3757
  • locus tag: SAUSA300_0314 [new locus tag: SAUSA300_RS01675 ]
  • pan locus tag?: SAUPAN001238000
  • symbol: SAUSA300_0314
  • pan gene symbol?: nanT
  • synonym:
  • product: sodium:solute symporter family protein

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SAUSA300_0314 [new locus tag: SAUSA300_RS01675 ]
  • symbol: SAUSA300_0314
  • product: sodium:solute symporter family protein
  • replicon: chromosome
  • strand: -
  • coordinates: 365200..366732
  • length: 1533
  • essential: unknown other strains

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    1381
    1441
    1501
    ATGAAAGAAGTTGGATTTGGCACACTAAACTGGGTTGCCGTTATCATTTATCTACTAGCT
    ATGTTGTTCATTGGCGTTTATTTTACCAAGCGCGCGAGCCAAAGTACCAATAGTTTCTTT
    ACCGCAAGTGGTCGCTTGCCATCTTGGGTAGTTGGCTTTTCAATTTATGCTACTACGTTA
    AGTGCGATTACATTTATGTCGACACCAGAGAAAGCATTTTTAACAGATTGGTCATATATC
    GCTGGTAACATTGCTATCGTCGCAATTATTCCATTACTTATTTATTTCTATGTCCCTTTC
    TTTAAAAAGTTAAAGGTAACATCTGCATATGAATATTTAGAAGCTAGATTTGGCCCTAGC
    ATACGTGTCATTGGCTCATTATTATTTGTCGTTTACCATTTAGGGCGTGTTGCAATTGTT
    ATCTACTTACCAACATTAGCAATCACATCTGTATCAGACATGAACCCTTATATCGTTGCA
    TCACTCGTTGGTTTACTATGTATTTTATATACATTTTTAGGTGGTTTCGAAGGTGTGGTT
    TGGAGTGATTTCATTCAAGGCGTCATTTTATTAGGCGGCGCTTTAGTTATTATTATTCTA
    GGTGTTGTGAACATTAAAGGCGGTTTCGGCACTGTCTTTGCAGATGCGATTGAGCACAAA
    AAATTAATTAGTGCAGACAATTGGAAACTAAATACTGCGGCAGCTGCCATTCCAATTATT
    TTCCTAGGAAATATTTTCAACAACTTGTATCAATACACAGCGAGTCAAGACGTCGTGCAG
    CGTTATCAAGCTTCTGATAGTTTAAAAGAAACAAATAAATCGTTATGGACAAATGGTATC
    CTAGCTTTAATTTCAGCACCCTTATTTTATGGTATGGGTACAATGCTGTATTCATTTTAT
    ACACATGAAGCTGTTTTACCAAAAGGCTTCAATACATCATCTGTAGTGCCATATTTCATT
    TTGACTGAGATGCCACCATTTGTAGCAGGATTACTTATTGCAGCCATTTTCGCCGCTGCA
    CAGTCTACCATTTCATCTAGTTTAAATTCTATATCTGCTTGTATTTCAATCGACATTAAG
    CAACGCTTCTTCGGAAAAGGTAGCGAGCGACACGAAGTTAACTTTGCACGTTTCATTATT
    ATCATTGCAGGTATTTTCGGTTTTGGAATGTCACTATACTTAATTGCTTCTAATTCAAAT
    GACTTATGGGATTTATTCTTGTTTGTGACTGGATTATTCGGCGTTCCATTGGCTGGTGTA
    TTTGCAGTTGGTATTTTCACTAAACGTACGAATACATTCGGTGTTATTTGTGGATTAATA
    TTGGGTATCATCTTTGCTTATGTCTATAATGGTGTTGGCAAAGGTAACTCACCTTTCTAT
    GTATCTACCATTTCATTTACAGTTGCTTTTGTCTTTGCTTATATACTTAGCTTCATTGTC
    CCTTCAAAACATAAAAAAGATATAACGGGATTAACAATTTTTGAAAAAGATAAACCATCA
    ACATACATTTCAAAAACGGCTACGAAAAAGTAG
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380
    1440
    1500
    1533

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SAUSA300_0314 [new locus tag: SAUSA300_RS01675 ]
  • symbol: SAUSA300_0314
  • description: sodium:solute symporter family protein
  • length: 510
  • theoretical pI: 9.58689
  • theoretical MW: 55813.2
  • GRAVY: 0.731569

Function[edit | edit source]

  • TIGRFAM:
    Metabolism Transport and binding proteins Cations and iron carrying compounds transporter, solute:sodium symporter (SSS) family (TIGR00813; HMM-score: 220.4)
    and 6 more
    Metabolism Transport and binding proteins Amino acids, peptides and amines sodium/proline symporter (TIGR02121; HMM-score: 97)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Pantothenate and coenzyme A sodium/pantothenate symporter (TIGR02119; HMM-score: 71.5)
    Metabolism Transport and binding proteins Other sodium/pantothenate symporter (TIGR02119; HMM-score: 71.5)
    probable sodium:solute symporter, VC_2705 subfamily (TIGR03648; HMM-score: 57.4)
    Metabolism Transport and binding proteins Carbohydrates, organic alcohols, and acids cation/acetate symporter ActP (TIGR02711; HMM-score: 31.9)
    Metabolism Transport and binding proteins Cations and iron carrying compounds multicomponent Na+:H+ antiporter (TIGR00942; HMM-score: 14.1)
  • TheSEED:  
    Cell Wall and Capsule Capsular and extracellular polysacchrides Sialic Acid Metabolism  Predicted sialic acid transporter
  • PFAM:
    APC (CL0062) SSF; Sodium:solute symporter family (PF00474; HMM-score: 140.4)
    and 2 more
    CopD_like (CL0430) UPF0093; Uncharacterised protein family (UPF0093) (PF03653; HMM-score: 12.5)
    no clan defined LRR19-TM; Leucine-rich repeat family 19 TM domain (PF15176; HMM-score: 8.7)

Structure, modifications & interactions[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic Membrane
    • Cytoplasmic Score: 0
    • Cytoplasmic Membrane Score: 10
    • Cellwall Score: 0
    • Extracellular Score: 0
    • Internal Helices: 12
  • LocateP: Multi-transmembrane
    • Prediction by SwissProt Classification: Membrane
    • Pathway Prediction: Sec-(SPI)
    • Intracellular possibility: 0.17
    • Signal peptide possibility: -0.5
    • N-terminally Anchored Score: -1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.043374
    • TAT(Tat/SPI): 0.001183
    • LIPO(Sec/SPII): 0.007584
  • predicted transmembrane helices (TMHMM): 13

Accession numbers[edit | edit source]

Protein sequence[edit | edit source]

  • MKEVGFGTLNWVAVIIYLLAMLFIGVYFTKRASQSTNSFFTASGRLPSWVVGFSIYATTLSAITFMSTPEKAFLTDWSYIAGNIAIVAIIPLLIYFYVPFFKKLKVTSAYEYLEARFGPSIRVIGSLLFVVYHLGRVAIVIYLPTLAITSVSDMNPYIVASLVGLLCILYTFLGGFEGVVWSDFIQGVILLGGALVIIILGVVNIKGGFGTVFADAIEHKKLISADNWKLNTAAAAIPIIFLGNIFNNLYQYTASQDVVQRYQASDSLKETNKSLWTNGILALISAPLFYGMGTMLYSFYTHEAVLPKGFNTSSVVPYFILTEMPPFVAGLLIAAIFAAAQSTISSSLNSISACISIDIKQRFFGKGSERHEVNFARFIIIIAGIFGFGMSLYLIASNSNDLWDLFLFVTGLFGVPLAGVFAVGIFTKRTNTFGVICGLILGIIFAYVYNGVGKGNSPFYVSTISFTVAFVFAYILSFIVPSKHKKDITGLTIFEKDKPSTYISKTATKK

Experimental data[edit | edit source]

  • experimentally validated: no data available

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulators: NanR* (repression) regulon, CcpA regulon
    NanR(TF)important in Sialic acid utilization, N-acetylglucosamine utilization; RegPrecise    transcription unit transferred from N315 data RegPrecise  
    CcpA(TF)important in Carbon catabolism; RegPrecise    transcription unit transferred from N315 data RegPrecise  

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

Relevant publications[edit | edit source]

Michael E Olson, Jessica M King, Timothy L Yahr, Alexander R Horswill
Sialic acid catabolism in Staphylococcus aureus.
J Bacteriol: 2013, 195(8);1779-88
[PubMed:23396916] [WorldCat.org] [DOI] (I p)