Jump to navigation
Jump to search
NCBI: 10-JUN-2013
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus USA300_FPR3757
- locus tag: SAUSA300_0818 [new locus tag: SAUSA300_RS04410 ]
- pan locus tag?: SAUPAN002894000
- symbol: sufC
- pan gene symbol?: sufC
- synonym:
- product: FeS assembly ATPase SufC
⊟Additional information (user-provided)[edit | edit source]
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: SAUSA300_0818 [new locus tag: SAUSA300_RS04410 ]
- symbol: sufC
- product: FeS assembly ATPase SufC
- replicon: chromosome
- strand: +
- coordinates: 897769..898530
- length: 762
- essential: unknown other strains
⊟Accession numbers[edit | edit source]
- Gene ID: 3912971 NCBI
- RefSeq: YP_493518 NCBI
- BioCyc: see SAUSA300_RS04410
- MicrobesOnline: 1292333 MicrobesOnline
⊟Phenotype[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301
361
421
481
541
601
661
721ATGGCATCAACATTAGAAATCAAAGACCTACATGTGTCTATTGAGGATAAAGAAATCTTA
AAAGGTGTTAACTTGACAATTAACACTGATGAAATACATGCGATTATGGGACCAAACGGG
ACAGGTAAATCAACTTTATCATCTGCAATTATGGGACACCCAAGCTATGAAGTAACTAAA
GGAGAAGTACTTTTAGACGGTGTAAATATTTTAGAATTAGAAGTTGATGAAAGAGCAAAA
GCAGGATTATTCTTGGCAATGCAATATCCATCAGAAATTACAGGTGTTACAAATGCTGAT
TTCATGCGTTCAGCAATCAATGCGAAACGTGAAGAAGGACAAGAAATCAACTTAATGCAA
TTTATTAAGAAATTAGATAAAAACATGGATTTTCTAGACATAGATAAAGACATGGCACAA
CGTTATTTAAATGAAGGTTTCTCAGGTGGAGAGAAGAAACGTAACGAAATCTTACAATTA
ATGATGTTAGAACCTAAGTTTGCAATCTTAGATGAAATCGATTCAGGGTTAGACATCGAT
GCATTAAAAGTTGTATCTAAAGGTATTAACCAAATGCGTGGGGAAAACTTTGGTGCATTA
ATGATTACACACTATCAACGATTATTAAATTACATTACTCCTGATAAAGTACATGTAATG
TATGCTGGTAAAGTCGTTAAATCTGGTGGTCCAGAATTAGCAAAACGTCTTGAAGAAGAA
GGATATGAATGGGTTAAAGAAGAGTTCGGTTCAGCTGAATAA60
120
180
240
300
360
420
480
540
600
660
720
762
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: SAUSA300_0818 [new locus tag: SAUSA300_RS04410 ]
- symbol: SufC
- description: FeS assembly ATPase SufC
- length: 253
- theoretical pI: 4.61058
- theoretical MW: 28275.2
- GRAVY: -0.303162
⊟Function[edit | edit source]
- TIGRFAM: Biosynthesis of cofactors, prosthetic groups, and carriers Other FeS assembly ATPase SufC (TIGR01978; HMM-score: 369.2)and 73 moreCell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides LPS export ABC transporter ATP-binding protein (TIGR04406; HMM-score: 104)Transport and binding proteins Other LPS export ABC transporter ATP-binding protein (TIGR04406; HMM-score: 104)Transport and binding proteins Amino acids, peptides and amines urea ABC transporter, ATP-binding protein UrtE (TIGR03410; HMM-score: 83.7)Transport and binding proteins Amino acids, peptides and amines urea ABC transporter, ATP-binding protein UrtD (TIGR03411; HMM-score: 81.4)Transport and binding proteins Unknown substrate energy-coupling factor transporter ATPase (TIGR04520; EC 3.6.3.-; HMM-score: 81.3)Transport and binding proteins Other daunorubicin resistance ABC transporter, ATP-binding protein (TIGR01188; HMM-score: 74.1)Transport and binding proteins Unknown substrate energy-coupling factor transporter ATPase (TIGR04521; EC 3.6.3.-; HMM-score: 73.9)Transport and binding proteins Cations and iron carrying compounds nickel import ATP-binding protein NikE (TIGR02769; EC 3.6.3.24; HMM-score: 72.9)Transport and binding proteins Anions phosphate ABC transporter, ATP-binding protein (TIGR00972; EC 3.6.3.27; HMM-score: 70.9)ABC transporter, permease/ATP-binding protein (TIGR02204; HMM-score: 69.1)Transport and binding proteins Carbohydrates, organic alcohols, and acids ABC transporter, ATP-binding subunit, PQQ-dependent alcohol dehydrogenase system (TIGR03864; HMM-score: 69)Cellular processes Pathogenesis type I secretion system ATPase (TIGR03375; HMM-score: 67.8)Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR03375; HMM-score: 67.8)proposed F420-0 ABC transporter, ATP-binding protein (TIGR03873; HMM-score: 66.5)Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR01842; HMM-score: 65.6)Transport and binding proteins Amino acids, peptides and amines putative 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TIGR03265; HMM-score: 65.3)thiol reductant ABC exporter, CydD subunit (TIGR02857; HMM-score: 65)Transport and binding proteins Cations and iron carrying compounds nickel import ATP-binding protein NikD (TIGR02770; HMM-score: 63.3)Transport and binding proteins Cations and iron carrying compounds cobalt ABC transporter, ATP-binding protein (TIGR01166; HMM-score: 61.8)Transport and binding proteins Anions sulfate ABC transporter, ATP-binding protein (TIGR00968; EC 3.6.3.25; HMM-score: 59.9)Energy metabolism Methanogenesis methyl coenzyme M reductase system, component A2 (TIGR03269; HMM-score: 59)Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides lipid A export permease/ATP-binding protein MsbA (TIGR02203; HMM-score: 58.9)Transport and binding proteins Other lipid A export permease/ATP-binding protein MsbA (TIGR02203; HMM-score: 58.9)Transport and binding proteins Other antigen peptide transporter 2 (TIGR00958; HMM-score: 57.4)Transport and binding proteins Other pigment precursor permease (TIGR00955; HMM-score: 56.5)Cellular processes Biosynthesis of natural products NHLM bacteriocin system ABC transporter, peptidase/ATP-binding protein (TIGR03796; HMM-score: 56.2)Transport and binding proteins Amino acids, peptides and amines NHLM bacteriocin system ABC transporter, peptidase/ATP-binding protein (TIGR03796; HMM-score: 56.2)Cellular processes Biosynthesis of natural products NHLM bacteriocin system ABC transporter, ATP-binding protein (TIGR03797; HMM-score: 56.2)Transport and binding proteins Amino acids, peptides and amines NHLM bacteriocin system ABC transporter, ATP-binding protein (TIGR03797; HMM-score: 56.2)2-aminoethylphosphonate ABC transport system, ATP-binding component PhnT (TIGR03258; HMM-score: 55.6)Cellular processes Toxin production and resistance putative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 55.4)Transport and binding proteins Unknown substrate putative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 55.4)thiol reductant ABC exporter, CydC subunit (TIGR02868; HMM-score: 52.8)Protein fate Protein and peptide secretion and trafficking ABC-type bacteriocin transporter (TIGR01193; HMM-score: 51.2)Protein fate Protein modification and repair ABC-type bacteriocin transporter (TIGR01193; HMM-score: 51.2)Transport and binding proteins Other ABC-type bacteriocin transporter (TIGR01193; HMM-score: 51.2)lantibiotic protection ABC transporter, ATP-binding subunit (TIGR03740; HMM-score: 50.9)Transport and binding proteins Anions phosphonate ABC transporter, ATP-binding protein (TIGR02315; EC 3.6.3.28; HMM-score: 50.3)Protein fate Protein and peptide secretion and trafficking lipoprotein releasing system, ATP-binding protein (TIGR02211; EC 3.6.3.-; HMM-score: 49.9)ATP-binding cassette protein, ChvD family (TIGR03719; HMM-score: 49.2)Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR01846; HMM-score: 49)ABC exporter ATP-binding subunit, DevA family (TIGR02982; HMM-score: 48.7)ectoine/hydroxyectoine ABC transporter, ATP-binding protein EhuA (TIGR03005; HMM-score: 47.9)Transport and binding proteins Carbohydrates, organic alcohols, and acids D-xylose ABC transporter, ATP-binding protein (TIGR02633; EC 3.6.3.17; HMM-score: 47.4)Protein fate Protein and peptide secretion and trafficking heme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 47.3)Transport and binding proteins Other heme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 47.3)Transport and binding proteins Amino acids, peptides and amines glycine betaine/L-proline transport ATP binding subunit (TIGR01186; HMM-score: 45.3)Transport and binding proteins Other thiamine ABC transporter, ATP-binding protein (TIGR01277; EC 3.6.3.-; HMM-score: 43.3)Cellular processes Other nodulation ABC transporter NodI (TIGR01288; HMM-score: 42.3)Transport and binding proteins Other nodulation ABC transporter NodI (TIGR01288; HMM-score: 42.3)Transport and binding proteins Carbohydrates, organic alcohols, and acids glucan exporter ATP-binding protein (TIGR01192; EC 3.6.3.42; HMM-score: 41.7)D-methionine ABC transporter, ATP-binding protein (TIGR02314; EC 3.6.3.-; HMM-score: 41.1)Cellular processes Cell division cell division ATP-binding protein FtsE (TIGR02673; HMM-score: 41)Transport and binding proteins Anions nitrate ABC transporter, ATP-binding proteins C and D (TIGR01184; HMM-score: 40.2)Transport and binding proteins Other nitrate ABC transporter, ATP-binding proteins C and D (TIGR01184; HMM-score: 40.2)Transport and binding proteins Other pleiotropic drug resistance family protein (TIGR00956; HMM-score: 39.9)Transport and binding proteins Unknown substrate anchored repeat-type ABC transporter, ATP-binding subunit (TIGR03771; HMM-score: 39.5)phosphonate C-P lyase system protein PhnL (TIGR02324; HMM-score: 39.2)Transport and binding proteins Amino acids, peptides and amines polyamine ABC transporter, ATP-binding protein (TIGR01187; EC 3.6.3.31; HMM-score: 38)gliding motility-associated ABC transporter ATP-binding subunit GldA (TIGR03522; HMM-score: 37.5)Transport and binding proteins Anions molybdate ABC transporter, ATP-binding protein (TIGR02142; EC 3.6.3.29; HMM-score: 36.3)Transport and binding proteins Carbohydrates, organic alcohols, and acids peroxysomal long chain fatty acyl transporter (TIGR00954; HMM-score: 29.4)Central intermediary metabolism Phosphorus compounds phosphonate C-P lyase system protein PhnK (TIGR02323; HMM-score: 29.4)Transport and binding proteins Amino acids, peptides and amines cyclic peptide transporter (TIGR01194; HMM-score: 26)Transport and binding proteins Other cyclic peptide transporter (TIGR01194; HMM-score: 26)Transport and binding proteins Other multi drug resistance-associated protein (MRP) (TIGR00957; HMM-score: 24.3)Transport and binding proteins Other rim ABC transporter (TIGR01257; HMM-score: 19.4)Transport and binding proteins Amino acids, peptides and amines choline ABC transporter, ATP-binding protein (TIGR03415; HMM-score: 19.2)Transport and binding proteins Anions cystic fibrosis transmembrane conductor regulator (CFTR) (TIGR01271; EC 3.6.3.49; HMM-score: 16.7)Cellular processes Cell division chromosome segregation protein SMC (TIGR02168; HMM-score: 15.3)DNA metabolism Chromosome-associated proteins chromosome segregation protein SMC (TIGR02168; HMM-score: 15.3)carbohydrate kinase, thermoresistant glucokinase family (TIGR01313; EC 2.7.1.-; HMM-score: 12.7)DNA metabolism DNA replication, recombination, and repair excinuclease ABC subunit A (TIGR00630; EC 3.1.25.-; HMM-score: 12.2)
- TheSEED :
- Iron-sulfur cluster assembly ATPase protein SufC
- PFAM: P-loop_NTPase (CL0023) ABC_tran; ABC transporter (PF00005; HMM-score: 81.8)and 21 moreSMC_N; RecF/RecN/SMC N terminal domain (PF02463; HMM-score: 35.9)Aha1_BPI (CL0648) DUF1439; Protein of unknown function (DUF1439) (PF07273; HMM-score: 20.3)P-loop_NTPase (CL0023) AAA_29; P-loop containing region of AAA domain (PF13555; HMM-score: 20)AAA_28; AAA domain (PF13521; HMM-score: 19.8)RsgA_GTPase; RsgA GTPase (PF03193; HMM-score: 17.3)AAA_27; AAA domain (PF13514; HMM-score: 16.7)AAA_21; AAA domain, putative AbiEii toxin, Type IV TA system (PF13304; HMM-score: 16.4)AAA_15; AAA ATPase domain (PF13175; HMM-score: 16.2)AAA_18; AAA domain (PF13238; HMM-score: 16.2)AAA_14; AAA domain (PF13173; HMM-score: 16.1)AAA; ATPase family associated with various cellular activities (AAA) (PF00004; HMM-score: 15.2)AAA_23; AAA domain (PF13476; HMM-score: 15)AAA_13; AAA domain (PF13166; HMM-score: 14.3)AAA_33; AAA domain (PF13671; HMM-score: 14)no clan defined PFam54_60; Borrelia Bbcrasp-1 domain containing protein (PF05714; HMM-score: 13.6)P-loop_NTPase (CL0023) AAA_25; AAA domain (PF13481; HMM-score: 13.5)GT-B (CL0113) Glyco_trans_4_2; Glycosyl transferase 4-like (PF13477; HMM-score: 13.4)P-loop_NTPase (CL0023) AAA_22; AAA domain (PF13401; HMM-score: 13.3)AAA_5; AAA domain (dynein-related subfamily) (PF07728; HMM-score: 13.2)Adhesin (CL0204) Sgo0707_N2; Sgo0707 N2 domain (PF20623; HMM-score: 12)no clan defined DUF1420; Protein of unknown function (DUF1420) (PF07220; HMM-score: 10.1)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic
- Cytoplasmic Score: 9.97
- Cytoplasmic Membrane Score: 0
- Cellwall Score: 0.01
- Extracellular Score: 0.02
- Internal Helices: 0
- DeepLocPro: Cytoplasmic
- Cytoplasmic Score: 0.73
- Cytoplasmic Membrane Score: 0.2395
- Cell wall & surface Score: 0
- Extracellular Score: 0.0304
- LocateP: Intracellular
- Prediction by SwissProt Classification: Cytoplasmic
- Pathway Prediction: No pathway
- Intracellular possibility: 1
- Signal peptide possibility: -1
- N-terminally Anchored Score: -1
- Predicted Cleavage Site: No CleavageSite
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.007752
- TAT(Tat/SPI): 0.000871
- LIPO(Sec/SPII): 0.000474
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Protein sequence[edit | edit source]
- MASTLEIKDLHVSIEDKEILKGVNLTINTDEIHAIMGPNGTGKSTLSSAIMGHPSYEVTKGEVLLDGVNILELEVDERAKAGLFLAMQYPSEITGVTNADFMRSAINAKREEGQEINLMQFIKKLDKNMDFLDIDKDMAQRYLNEGFSGGEKKRNEILQLMMLEPKFAILDEIDSGLDIDALKVVSKGINQMRGENFGALMITHYQRLLNYITPDKVHVMYAGKVVKSGGPELAKRLEEEGYEWVKEEFGSAE
⊟Experimental data[edit | edit source]
- experimentally validated: data available for COL, NCTC8325
- protein localization: data available for COL
- quantitative data / protein copy number per cell: data available for COL
- interaction partners:
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
- MicrobesOnline: sufC > sufD > sufS > SAUSA300_0821 > sufB
⊟Regulation[edit | edit source]
- regulator: PerR* (repression) regulon
PerR* (TF) important in Oxidative stress response; RegPrecise
⊟Additional information (user-provided)[edit | edit source]
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Other information (user-provided)[edit | edit source]
You can add further information about the gene and protein here. [edit]
⊟Literature[edit | edit source]
⊟References[edit | edit source]