Jump to navigation
Jump to search
PangenomeCOLN315NCTC8325NewmanUSA300_FPR3757JSNZ04-0298108BA0217611819-97685071193ECT-R 2ED133ED98HO 5096 0412JH1JH9JKD6008JKD6159LGA251M013MRSA252MSHR1132MSSA476MW2Mu3Mu50RF122ST398T0131TCH60TW20USA300_TCH1516VC40
NCBI: 10-JUN-2013
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus USA300_FPR3757
- locus tag: SAUSA300_1434 [new locus tag: SAUSA300_RS07825 ]
- pan locus tag?: SAUPAN001314000
- symbol: SAUSA300_1434
- pan gene symbol?: —
- synonym:
- product: phiSLT ORF104a-like protein, repressor
⊟Additional information (user-provided)[edit | edit source]
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: SAUSA300_1434 [new locus tag: SAUSA300_RS07825 ]
- symbol: SAUSA300_1434
- product: phiSLT ORF104a-like protein, repressor
- replicon: chromosome
- strand: +
- coordinates: 1588081..1588410
- length: 330
- essential: unknown
⊟Accession numbers[edit | edit source]
- Gene ID: 3913727 NCBI
- RefSeq: YP_494131 NCBI
- BioCyc: see SAUSA300_RS07825
- MicrobesOnline: 1292949 MicrobesOnline
⊟Phenotype[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301ATGGAGAATAATAAAGTCAGAAAAATTTTATCTGAAAACCTTCAAGAACTTATGAATGAT
AAAAATATTGATCAGAGAGAACTTGCTGAAGCTATTGGAGTTTCTCAACCTACAGTCTCC
AATTGGATTCAACAAACTAAATATCCACGAATTAAAAGAATTCAACAACTTGCAGATTAC
TTCAATGTACCGAAATCAAGAATTACTGAATCAAAAAAAGATATACATCAAGAAACAATT
GCTGCTCATTTTGATAAGGAGGGATTAACTGAAGAAGAGATTGAAGAAGTAAATAGATTC
ATTGAATGGGTTAGAAATAGAGACAAATAA60
120
180
240
300
330
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: SAUSA300_1434 [new locus tag: SAUSA300_RS07825 ]
- symbol: SAUSA300_1434
- description: phiSLT ORF104a-like protein, repressor
- length: 109
- theoretical pI: 5.81405
- theoretical MW: 12996.5
- GRAVY: -1.00642
⊟Function[edit | edit source]
- TIGRFAM: Unknown function General DNA binding domain, excisionase family (TIGR01764; HMM-score: 18.6)RNA polymerase sigma factor, sigma-70 family (TIGR02937; HMM-score: 18.3)nucleoid occlusion protein (TIGR04285; HMM-score: 18.1)ParB/RepB/Spo0J family partition protein (TIGR00180; HMM-score: 18)Mobile and extrachromosomal element functions Other addiction module antidote protein, HigA family (TIGR02607; HMM-score: 17.8)Regulatory functions DNA interactions addiction module antidote protein, HigA family (TIGR02607; HMM-score: 17.8)Regulatory functions Protein interactions addiction module antidote protein, HigA family (TIGR02607; HMM-score: 17.8)Regulatory functions DNA interactions transcriptional regulator, y4mF family (TIGR03070; HMM-score: 16.4)Amino acid biosynthesis Glutamate family arginine repressor (TIGR01529; HMM-score: 15.9)Regulatory functions DNA interactions arginine repressor (TIGR01529; HMM-score: 15.9)and 2 moreEPS-associated transcriptional regulator, MarR family (TIGR04176; HMM-score: 13.4)putative zinc finger/helix-turn-helix protein, YgiT family (TIGR03830; HMM-score: 12.5)
- TheSEED :
- Phage repressor protein cI
- PFAM: HTH (CL0123) HTH_3; Helix-turn-helix (PF01381; HMM-score: 47.9)HTH_26; Cro/C1-type HTH DNA-binding domain (PF13443; HMM-score: 43.4)and 40 morePhage_CI_repr; Bacteriophage CI repressor helix-turn-helix domain (PF07022; HMM-score: 31.5)HTH_31; Helix-turn-helix domain (PF13560; HMM-score: 26.6)HTH_10; HTH DNA binding domain (PF04967; HMM-score: 24.9)HTH_24; Winged helix-turn-helix DNA-binding (PF13412; HMM-score: 24.1)YdaS_toxin; Bacterial toxin YdaS (PF15943; HMM-score: 23.7)HTH_19; Helix-turn-helix domain (PF12844; HMM-score: 23)HTH_23; Homeodomain-like domain (PF13384; HMM-score: 22.8)MarR; MarR family (PF01047; HMM-score: 22.5)HTH_37; Helix-turn-helix domain (PF13744; HMM-score: 22)MarR_2; MarR family (PF12802; HMM-score: 21.2)HTH_5; Bacterial regulatory protein, arsR family (PF01022; HMM-score: 20.7)HTH_AsnC-type; AsnC-type helix-turn-helix domain (PF13404; HMM-score: 20.7)HTH_17; Helix-turn-helix domain (PF12728; HMM-score: 20.2)HNF-1_N; Hepatocyte nuclear factor 1 (HNF-1), N terminus (PF04814; HMM-score: 19.9)HTH_11; HTH domain (PF08279; HMM-score: 19.3)HTH_28; Helix-turn-helix domain (PF13518; HMM-score: 17.5)no clan defined CENPH; CENPH protein (PF20993; HMM-score: 17.5)HTH (CL0123) Homeodomain; Homeodomain (PF00046; HMM-score: 17.2)HTH_Crp_2; Crp-like helix-turn-helix domain (PF13545; HMM-score: 17)Phage_CII; Bacteriophage CII protein (PF05269; HMM-score: 16.6)Fe_dep_repress; Iron dependent repressor, N-terminal DNA binding domain (PF01325; HMM-score: 16.2)HTH_36; Helix-turn-helix domain (PF13730; HMM-score: 16.1)GntR; Bacterial regulatory proteins, gntR family (PF00392; HMM-score: 15.6)P22_Cro; DNA-binding transcriptional regulator Cro (PF14549; HMM-score: 15.4)Sigma70_r4; Sigma-70, region 4 (PF04545; HMM-score: 15)Sigma70_r4_2; Sigma-70, region 4 (PF08281; HMM-score: 15)HHH (CL0198) DUF4332; Domain of unknown function (DUF4332) (PF14229; HMM-score: 14.8)HTH (CL0123) TrmB; Sugar-specific transcriptional regulator TrmB (PF01978; HMM-score: 14.6)PDDEXK (CL0236) DUF4143; Domain of unknown function (DUF4143) (PF13635; HMM-score: 14.4)HTH (CL0123) LacI; Bacterial regulatory proteins, lacI family (PF00356; HMM-score: 14.1)CUT; CUT domain (PF02376; HMM-score: 14)Xre-like-HTH; Antitoxin Xre-like helix-turn-helix domain (PF20432; HMM-score: 14)Terminase_5; Putative ATPase subunit of terminase (gpP-like) (PF06056; HMM-score: 13.8)YfeC-like; Transcription regulator YfeC-like (PF07037; HMM-score: 13.7)HTH_IclR; IclR helix-turn-helix domain (PF09339; HMM-score: 13.7)HTH_1; Bacterial regulatory helix-turn-helix protein, lysR family (PF00126; HMM-score: 13.4)NUMOD1; NUMOD1 domain (PF07453; HMM-score: 13.1)no clan defined DUF6398; Domain of unknown function (DUF6398) (PF19935; HMM-score: 13)HTH (CL0123) Phage_terminase; Phage terminase small subunit (PF10668; HMM-score: 12.6)HTH_50; Helix-turn-helix domain (PF18024; HMM-score: 12.3)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic
- Cytoplasmic Score: 7.5
- Cytoplasmic Membrane Score: 1.15
- Cellwall Score: 0.62
- Extracellular Score: 0.73
- Internal Helices: 0
- DeepLocPro: Cytoplasmic
- Cytoplasmic Score: 0.9467
- Cytoplasmic Membrane Score: 0.0036
- Cell wall & surface Score: 0.0019
- Extracellular Score: 0.0478
- LocateP: Intracellular
- Prediction by SwissProt Classification: Cytoplasmic
- Pathway Prediction: No pathway
- Intracellular possibility: 1
- Signal peptide possibility: -1
- N-terminally Anchored Score: 1
- Predicted Cleavage Site: No CleavageSite
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.00762
- TAT(Tat/SPI): 0.000616
- LIPO(Sec/SPII): 0.000808
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Protein sequence[edit | edit source]
- MENNKVRKILSENLQELMNDKNIDQRELAEAIGVSQPTVSNWIQQTKYPRIKRIQQLADYFNVPKSRITESKKDIHQETIAAHFDKEGLTEEEIEEVNRFIEWVRNRDK
⊟Experimental data[edit | edit source]
- experimentally validated:
- protein localization:
- quantitative data / protein copy number per cell:
- interaction partners:
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
⊟Regulation[edit | edit source]
- regulator:
⊟Additional information (user-provided)[edit | edit source]
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: no data available
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
- Aureolib: no data available
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Other information (user-provided)[edit | edit source]
You can add further information about the gene and protein here. [edit]
⊟Literature[edit | edit source]
⊟References[edit | edit source]