PangenomeCOLN315NCTC8325NewmanUSA300_FPR375704-0298108BA0217611819-97685071193ECT-R 2ED133ED98HO 5096 0412JH1JH9JKD6008JKD6159JSNZLGA251M013MRSA252MSHR1132MSSA476MW2Mu3Mu50RF122ST398T0131TCH60TW20USA300_TCH1516VC40

NCBI: 10-JUN-2013

⊟Summary

• organism: Staphylococcus aureus USA300_FPR3757
• locus tag: SAUSA300_1434 [new locus tag: SAUSA300_RS07825 ]
• pan locus tag^?: SAUPAN001314000
• symbol: SAUSA300_1434
• pan gene symbol^?: —
• synonym:
• product: phiSLT ORF104a-like protein, repressor

⊟Genome View

⊟Gene

⊟General

• type: CDS
• locus tag: SAUSA300_1434 [new locus tag: SAUSA300_RS07825 ]
• symbol: SAUSA300_1434
• product: phiSLT ORF104a-like protein, repressor
• replicon: chromosome
• strand: +
• coordinates: 1588081..1588410
• length: 330
• essential: unknown

⊟Accession numbers

• Gene ID: 3913727 NCBI
• RefSeq: YP_494131 NCBI
• BioCyc: see SAUSA300_RS07825
• MicrobesOnline: 1292949 MicrobesOnline

⊟Phenotype

Share your knowledge and add information here. [edit]

⊟DNA sequence

• 1
  61
  121
  181
  241
  301
  
  ATGGAGAATAATAAAGTCAGAAAAATTTTATCTGAAAACCTTCAAGAACTTATGAATGAT
  AAAAATATTGATCAGAGAGAACTTGCTGAAGCTATTGGAGTTTCTCAACCTACAGTCTCC
  AATTGGATTCAACAAACTAAATATCCACGAATTAAAAGAATTCAACAACTTGCAGATTAC
  TTCAATGTACCGAAATCAAGAATTACTGAATCAAAAAAAGATATACATCAAGAAACAATT
  GCTGCTCATTTTGATAAGGAGGGATTAACTGAAGAAGAGATTGAAGAAGTAAATAGATTC
  ATTGAATGGGTTAGAAATAGAGACAAATAA
  60
  120
  180
  240
  300
  330
  

⊟Protein

⊟General

• locus tag: SAUSA300_1434 [new locus tag: SAUSA300_RS07825 ]
• symbol: SAUSA300_1434
• description: phiSLT ORF104a-like protein, repressor
• length: 109
• theoretical pI: 5.81405
• theoretical MW: 12996.5
• GRAVY: -1.00642

⊟Function

• TIGRFAM:
  Unknown function General DNA binding domain, excisionase family (TIGR01764; HMM-score: 18.6)
  RNA polymerase sigma factor, sigma-70 family (TIGR02937; HMM-score: 18.3)
  nucleoid occlusion protein (TIGR04285; HMM-score: 18.1)
  ParB/RepB/Spo0J family partition protein (TIGR00180; HMM-score: 18)
  Genetic information processing Mobile and extrachromosomal element functions Other addiction module antidote protein, HigA family (TIGR02607; HMM-score: 17.8)
  Signal transduction Regulatory functions DNA interactions addiction module antidote protein, HigA family (TIGR02607; HMM-score: 17.8)
  Signal transduction Regulatory functions Protein interactions addiction module antidote protein, HigA family (TIGR02607; HMM-score: 17.8)
  Signal transduction Regulatory functions DNA interactions transcriptional regulator, y4mF family (TIGR03070; HMM-score: 16.4)
  Metabolism Amino acid biosynthesis Glutamate family arginine repressor (TIGR01529; HMM-score: 15.9)
  Signal transduction Regulatory functions DNA interactions arginine repressor (TIGR01529; HMM-score: 15.9)
  and 2 more
  EPS-associated transcriptional regulator, MarR family (TIGR04176; HMM-score: 13.4)
  putative zinc finger/helix-turn-helix protein, YgiT family (TIGR03830; HMM-score: 12.5)
• TheSEED  :
  • Phage repressor protein cI
• PFAM:
  HTH (CL0123) HTH_3; Helix-turn-helix (PF01381; HMM-score: 47.9)
  HTH_26; Cro/C1-type HTH DNA-binding domain (PF13443; HMM-score: 43.4)
  and 40 more
  Phage_CI_repr; Bacteriophage CI repressor helix-turn-helix domain (PF07022; HMM-score: 31.5)
  HTH_31; Helix-turn-helix domain (PF13560; HMM-score: 26.6)
  HTH_10; HTH DNA binding domain (PF04967; HMM-score: 24.9)
  HTH_24; Winged helix-turn-helix DNA-binding (PF13412; HMM-score: 24.1)
  YdaS_toxin; Bacterial toxin YdaS (PF15943; HMM-score: 23.7)
  HTH_19; Helix-turn-helix domain (PF12844; HMM-score: 23)
  HTH_23; Homeodomain-like domain (PF13384; HMM-score: 22.8)
  MarR; MarR family (PF01047; HMM-score: 22.5)
  HTH_37; Helix-turn-helix domain (PF13744; HMM-score: 22)
  MarR_2; MarR family (PF12802; HMM-score: 21.2)
  HTH_5; Bacterial regulatory protein, arsR family (PF01022; HMM-score: 20.7)
  HTH_AsnC-type; AsnC-type helix-turn-helix domain (PF13404; HMM-score: 20.7)
  HTH_17; Helix-turn-helix domain (PF12728; HMM-score: 20.2)
  HNF-1_N; Hepatocyte nuclear factor 1 (HNF-1), N terminus (PF04814; HMM-score: 19.9)
  HTH_11; HTH domain (PF08279; HMM-score: 19.3)
  HTH_28; Helix-turn-helix domain (PF13518; HMM-score: 17.5)
  no clan defined CENPH; CENPH protein (PF20993; HMM-score: 17.5)
  HTH (CL0123) Homeodomain; Homeodomain (PF00046; HMM-score: 17.2)
  HTH_Crp_2; Crp-like helix-turn-helix domain (PF13545; HMM-score: 17)
  Phage_CII; Bacteriophage CII protein (PF05269; HMM-score: 16.6)
  Fe_dep_repress; Iron dependent repressor, N-terminal DNA binding domain (PF01325; HMM-score: 16.2)
  HTH_36; Helix-turn-helix domain (PF13730; HMM-score: 16.1)
  GntR; Bacterial regulatory proteins, gntR family (PF00392; HMM-score: 15.6)
  P22_Cro; DNA-binding transcriptional regulator Cro (PF14549; HMM-score: 15.4)
  Sigma70_r4; Sigma-70, region 4 (PF04545; HMM-score: 15)
  Sigma70_r4_2; Sigma-70, region 4 (PF08281; HMM-score: 15)
  HHH (CL0198) DUF4332; Domain of unknown function (DUF4332) (PF14229; HMM-score: 14.8)
  HTH (CL0123) TrmB; Sugar-specific transcriptional regulator TrmB (PF01978; HMM-score: 14.6)
  PDDEXK (CL0236) DUF4143; Domain of unknown function (DUF4143) (PF13635; HMM-score: 14.4)
  HTH (CL0123) LacI; Bacterial regulatory proteins, lacI family (PF00356; HMM-score: 14.1)
  CUT; CUT domain (PF02376; HMM-score: 14)
  Xre-like-HTH; Antitoxin Xre-like helix-turn-helix domain (PF20432; HMM-score: 14)
  Terminase_5; Putative ATPase subunit of terminase (gpP-like) (PF06056; HMM-score: 13.8)
  YfeC-like; Transcription regulator YfeC-like (PF07037; HMM-score: 13.7)
  HTH_IclR; IclR helix-turn-helix domain (PF09339; HMM-score: 13.7)
  HTH_1; Bacterial regulatory helix-turn-helix protein, lysR family (PF00126; HMM-score: 13.4)
  NUMOD1; NUMOD1 domain (PF07453; HMM-score: 13.1)
  no clan defined DUF6398; Domain of unknown function (DUF6398) (PF19935; HMM-score: 13)
  HTH (CL0123) Phage_terminase; Phage terminase small subunit (PF10668; HMM-score: 12.6)
  HTH_50; Helix-turn-helix domain (PF18024; HMM-score: 12.3)

⊟Structure, modifications & cofactors

• domains:
• modifications:
• cofactors:
• effectors:

⊟Localization

• PSORTb: Cytoplasmic
  • Cytoplasmic Score: 7.5
  • Cytoplasmic Membrane Score: 1.15
  • Cellwall Score: 0.62
  • Extracellular Score: 0.73
  • Internal Helices: 0
• DeepLocPro: Cytoplasmic
  • Cytoplasmic Score: 0.9467
  • Cytoplasmic Membrane Score: 0.0036
  • Cell wall & surface Score: 0.0019
  • Extracellular Score: 0.0478
• LocateP: Intracellular
  • Prediction by SwissProt Classification: Cytoplasmic
  • Pathway Prediction: No pathway
  • Intracellular possibility: 1
  • Signal peptide possibility: -1
  • N-terminally Anchored Score: 1
  • Predicted Cleavage Site: No CleavageSite
• SignalP: no predicted signal peptide
  • SP(Sec/SPI): 0.00762
  • TAT(Tat/SPI): 0.000616
  • LIPO(Sec/SPII): 0.000808
• predicted transmembrane helices (TMHMM): 0

⊟Accession numbers

• GI: 87161138 NCBI
• RefSeq: YP_494131 NCBI
• UniProt: A0A0H2XGJ1 UniProt

⊟Protein sequence

• MENNKVRKILSENLQELMNDKNIDQRELAEAIGVSQPTVSNWIQQTKYPRIKRIQQLADYFNVPKSRITESKKDIHQETIAAHFDKEGLTEEEIEEVNRFIEWVRNRDK

⊟Experimental data

• experimentally validated:
• protein localization:
• quantitative data / protein copy number per cell:
• interaction partners:

⊟Expression & Regulation

⊟Operon

• MicrobesOnline: SAUSA300_1434 > SAUSA300_1435 > SAUSA300_1436

⊟Regulation

• regulator:

⊟Transcription pattern

• S.aureus Expression Data Browser: no data available

⊟Protein synthesis (provided by Aureolib)

• Aureolib: no data available

⊟Protein stability

• half-life: no data available

⊟Biological Material

⊟Mutants

⊟Expression vector

⊟lacZ fusion

⊟GFP fusion

⊟two-hybrid system

⊟FLAG-tag construct

⊟Antibody

⊟Other Information

You are kindly invited to share additional interesting facts.

⊟Literature

⊟References

⊟Relevant publications