From AureoWiki
Jump to navigation Jump to search
PangenomeCOLN315NCTC8325NewmanUSA300_FPR375704-0298108BA0217611819-97685071193ECT-R 2ED133ED98HO 5096 0412JH1JH9JKD6008JKD6159LGA251M013MRSA252MSHR1132MSSA476MW2Mu3Mu50RF122ST398T0131TCH60TW20USA300_TCH1516VC40

NCBI: 10-JUN-2013

Summary[edit | edit source]

  • organism: Staphylococcus aureus USA300_FPR3757
  • locus tag: SAUSA300_1434 [new locus tag: SAUSA300_RS07825 ]
  • pan locus tag?: SAUPAN001314000
  • symbol: SAUSA300_1434
  • pan gene symbol?:
  • synonym:
  • product: phiSLT ORF104a-like protein, repressor

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SAUSA300_1434 [new locus tag: SAUSA300_RS07825 ]
  • symbol: SAUSA300_1434
  • product: phiSLT ORF104a-like protein, repressor
  • replicon: chromosome
  • strand: +
  • coordinates: 1588081..1588410
  • length: 330
  • essential: unknown

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    ATGGAGAATAATAAAGTCAGAAAAATTTTATCTGAAAACCTTCAAGAACTTATGAATGAT
    AAAAATATTGATCAGAGAGAACTTGCTGAAGCTATTGGAGTTTCTCAACCTACAGTCTCC
    AATTGGATTCAACAAACTAAATATCCACGAATTAAAAGAATTCAACAACTTGCAGATTAC
    TTCAATGTACCGAAATCAAGAATTACTGAATCAAAAAAAGATATACATCAAGAAACAATT
    GCTGCTCATTTTGATAAGGAGGGATTAACTGAAGAAGAGATTGAAGAAGTAAATAGATTC
    ATTGAATGGGTTAGAAATAGAGACAAATAA
    60
    120
    180
    240
    300
    330

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SAUSA300_1434 [new locus tag: SAUSA300_RS07825 ]
  • symbol: SAUSA300_1434
  • description: phiSLT ORF104a-like protein, repressor
  • length: 109
  • theoretical pI: 5.81405
  • theoretical MW: 12996.5
  • GRAVY: -1.00642

Function[edit | edit source]

  • TIGRFAM:
    Unknown function General DNA binding domain, excisionase family (TIGR01764; HMM-score: 18.6)
    RNA polymerase sigma factor, sigma-70 family (TIGR02937; HMM-score: 18.3)
    nucleoid occlusion protein (TIGR04285; HMM-score: 18.1)
    ParB/RepB/Spo0J family partition protein (TIGR00180; HMM-score: 18)
    Genetic information processing Mobile and extrachromosomal element functions Other addiction module antidote protein, HigA family (TIGR02607; HMM-score: 17.8)
    Signal transduction Regulatory functions DNA interactions addiction module antidote protein, HigA family (TIGR02607; HMM-score: 17.8)
    Signal transduction Regulatory functions Protein interactions addiction module antidote protein, HigA family (TIGR02607; HMM-score: 17.8)
    Signal transduction Regulatory functions DNA interactions transcriptional regulator, y4mF family (TIGR03070; HMM-score: 16.4)
    Metabolism Amino acid biosynthesis Glutamate family arginine repressor (TIGR01529; HMM-score: 15.9)
    Signal transduction Regulatory functions DNA interactions arginine repressor (TIGR01529; HMM-score: 15.9)
    and 2 more
    EPS-associated transcriptional regulator, MarR family (TIGR04176; HMM-score: 13.4)
    putative zinc finger/helix-turn-helix protein, YgiT family (TIGR03830; HMM-score: 12.5)
  • TheSEED  :
    • Phage repressor protein cI
  • PFAM:
    HTH (CL0123) HTH_3; Helix-turn-helix (PF01381; HMM-score: 49.1)
    HTH_26; Cro/C1-type HTH DNA-binding domain (PF13443; HMM-score: 40)
    and 37 more
    HTH_31; Helix-turn-helix domain (PF13560; HMM-score: 30.5)
    Phage_CI_repr; Bacteriophage CI repressor helix-turn-helix domain (PF07022; HMM-score: 28.9)
    YdaS_antitoxin; Putative antitoxin of bacterial toxin-antitoxin system, YdaS/YdaT (PF15943; HMM-score: 28.2)
    HTH_19; Helix-turn-helix domain (PF12844; HMM-score: 28)
    HTH_24; Winged helix-turn-helix DNA-binding (PF13412; HMM-score: 25.1)
    HTH_10; HTH DNA binding domain (PF04967; HMM-score: 24.9)
    HTH_37; Helix-turn-helix domain (PF13744; HMM-score: 23.4)
    HTH_23; Homeodomain-like domain (PF13384; HMM-score: 23.1)
    MarR; MarR family (PF01047; HMM-score: 22.2)
    HTH_AsnC-type; AsnC-type helix-turn-helix domain (PF13404; HMM-score: 20.7)
    Phage_terminase; Phage terminase small subunit (PF10668; HMM-score: 20.5)
    HTH_11; HTH domain (PF08279; HMM-score: 20.3)
    HTH_17; Helix-turn-helix domain (PF12728; HMM-score: 19.8)
    Homeobox; Homeobox domain (PF00046; HMM-score: 19.2)
    HTH_5; Bacterial regulatory protein, arsR family (PF01022; HMM-score: 19.2)
    HTH_28; Helix-turn-helix domain (PF13518; HMM-score: 19.1)
    HNF-1_N; Hepatocyte nuclear factor 1 (HNF-1), N terminus (PF04814; HMM-score: 18.8)
    MarR_2; MarR family (PF12802; HMM-score: 17.2)
    HTH_Crp_2; Crp-like helix-turn-helix domain (PF13545; HMM-score: 17.2)
    Phage_CII; Bacteriophage CII protein (PF05269; HMM-score: 16.6)
    Fe_dep_repress; Iron dependent repressor, N-terminal DNA binding domain (PF01325; HMM-score: 16.3)
    HTH_36; Helix-turn-helix domain (PF13730; HMM-score: 16)
    GntR; Bacterial regulatory proteins, gntR family (PF00392; HMM-score: 15.6)
    TrmB; Sugar-specific transcriptional regulator TrmB (PF01978; HMM-score: 15.3)
    P22_Cro; DNA-binding transcriptional regulator Cro (PF14549; HMM-score: 15.1)
    HTH_Tnp_1_2; Helix-turn-helix of insertion element transposase (PF13022; HMM-score: 15)
    LacI; Bacterial regulatory proteins, lacI family (PF00356; HMM-score: 14.9)
    Sigma70_r4_2; Sigma-70, region 4 (PF08281; HMM-score: 14.9)
    Terminase_5; Putative ATPase subunit of terminase (gpP-like) (PF06056; HMM-score: 14.8)
    Phage_AlpA; Prophage CP4-57 regulatory protein (AlpA) (PF05930; HMM-score: 14.5)
    DUF1323; Putative transcription regulator (DUF1323) (PF07037; HMM-score: 14.4)
    HHH (CL0198) DUF4332; Domain of unknown function (DUF4332) (PF14229; HMM-score: 14.4)
    HTH (CL0123) Sigma70_r4; Sigma-70, region 4 (PF04545; HMM-score: 14.1)
    NUMOD1; NUMOD1 domain (PF07453; HMM-score: 12.8)
    HTH_IclR; IclR helix-turn-helix domain (PF09339; HMM-score: 12.8)
    no clan defined DUF4250; Domain of unknown function (DUF4250) (PF14056; HMM-score: 12.6)
    HTH (CL0123) DUF2316; Uncharacterized protein conserved in bacteria (DUF2316) (PF10078; HMM-score: 12.5)

Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 1
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.00762
    • TAT(Tat/SPI): 0.000616
    • LIPO(Sec/SPII): 0.000808
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

Protein sequence[edit | edit source]

  • MENNKVRKILSENLQELMNDKNIDQRELAEAIGVSQPTVSNWIQQTKYPRIKRIQQLADYFNVPKSRITESKKDIHQETIAAHFDKEGLTEEEIEEVNRFIEWVRNRDK

Experimental data[edit | edit source]

  • experimentally validated:
  • protein localization:
  • quantitative data / protein copy number per cell:
  • interaction partners:

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

Relevant publications[edit | edit source]