From AureoWiki
Jump to navigation Jump to search

NCBI: 10-JUN-2013

Summary[edit | edit source]

  • organism: Staphylococcus aureus USA300_FPR3757
  • locus tag: SAUSA300_2494 [new locus tag: SAUSA300_RS13855 ]
  • pan locus tag?: SAUPAN006220000
  • symbol: SAUSA300_2494
  • pan gene symbol?: copA
  • synonym:
  • product: copper-translocating P-type ATPase

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SAUSA300_2494 [new locus tag: SAUSA300_RS13855 ]
  • symbol: SAUSA300_2494
  • product: copper-translocating P-type ATPase
  • replicon: chromosome
  • strand: +
  • coordinates: 2696542..2698950
  • length: 2409
  • essential: unknown other strains

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    1381
    1441
    1501
    1561
    1621
    1681
    1741
    1801
    1861
    1921
    1981
    2041
    2101
    2161
    2221
    2281
    2341
    2401
    GTGGCTAATACGAAAAAAACAACATTAGATATCACTGGTATGACTTGTGCCGCATGTTCA
    AATCGTATCGAAAAGAAACTGAATAAACTTGATGACGTTAATGCCCAAGTGAATTTAACT
    ACAGAGAAAGCAACTGTTGAGTATAACCCTGATCAACATGATGTCCAAGAATTTATTAAT
    ACGATTCAACATTTAGGTTACGGTGTCGCTGTAGAAACTGTCGAATTAGACATTACAGGT
    ATGACTTGTGCTGCATGCTCAAGCCGTATTGAAAAAGTGTTAAATAAAATGGACGGCGTT
    CAAAATGCAACGGTCAATTTAACAACAGAGCAAGCTAAAGTTGACTATTATCCTGAAGAA
    ACAGATGCTGATAAACTTGTCACTCGCATTCAAAAATTAGGTTATGACGCGTCTATTAAA
    GATAACAATAAAGATCAAACGTCACGCAAAGCTGAAGCGCTACAACATAAATTGATTAAG
    CTTATCATATCAGCAGTATTATCTTTACCACTATTAATGTTAATGTTTGTACATCTTTTC
    AATATGCATATACCAGCACTATTTACGAATCCATGGTTCCAATTTATTTTAGCTACACCT
    GTACAATTTATTATTGGATGGCAATTTTATGTAGGTGCTTATAAAAACTTAAGAAATGGT
    GGCGCCAATATGGATGTACTTGTTGCTGTTGGTACAAGTGCAGCATATTTTTACAGTATT
    TATGAAATGGTTCGTTGGCTAAATGGCTCAACAACGCAACCGCATTTATACTTTGAAACA
    AGCGCCGTACTAATTACCTTAATCTTATTCGGTAAGTATTTAGAAGCTAGAGCGAAGTCT
    CAAACAACCAATGCGCTTGGCGAATTATTAAGTTTACAAGCTAAAGAAGCACGCATTTTA
    AAAGATGGTAATGAAGTGATGATTCCTCTAAATGAAGTACATGTTGGAGATACACTTATC
    GTTAAACCAGGTGAAAAGATACCTGTTGATGGCAAAATTATTAAAGGTATGACTGCCATC
    GACGAATCTATGTTAACAGGTGAATCTATCCCTGTTGAGAAGAATGTTGATGATACTGTA
    ATTGGTTCAACGATGAACAAAAACGGTACTATTACTATGACAGCAACAAAAGTTGGCGGG
    GACACTGCGTTGGCAAATATTATTAAAGTTGTCGAAGAAGCTCAAAGTTCTAAAGCGCCG
    ATTCAACGATTGGCAGATATTATTTCTGGTTATTTCGTTCCTATCGTTGTTGGTATCGCA
    CTATTAACATTTATCGTGTGGATTACTTTAGTTACACCAGGTACATTTGAACCTGCACTT
    GTTGCGAGTATTTCCGTTCTCGTCATTGCTTGTCCATGCGCATTGGGACTTGCTACACCA
    ACTTCTATTATGGTAGGTACTGGTCGCGCTGCTGAAAATGGTATTTTATTTAAAGGTGGC
    GAGTTTGTTGAACGCACACATCAAATTGATACCATCGTTTTAGATAAGACGGGTACCATT
    ACAAATGGTCGTCCAGTCGTGACAGATTATCATGGTGACAATCAAACGCTACAACTACTT
    GCTACTGCTGAAAAAGATTCTGAACACCCATTGGCAGAAGCCATTGTCAATTATGCAAAA
    GAAAAGCAATTAATATTAACTGAGACAACAACATTTAAAGCAGTACCTGGCCATGGTATT
    GAAGCAACGATTGATCATCACTATATATTGGTTGGTAACCGTAAATTAATGGCTGACAAT
    GATATTAGCTTGCCTAAGCATATTTCTGATGATTTAACACATTATGAACGAGATGGTAAA
    ACTGCTATGCTCATTGCTGTTAATTATTCATTAACTGGTATCATCGCAGTGGCAGATACT
    GTCAAAGATCATGCCAAAGATGCTATAAAACAATTGCATGATATGGGCATTGAAGTTGCC
    ATGTTAACTGGCGATAATAAAAACACTGCTCAAGCCATTGCAAAACAAGTAGGCATAGAT
    ACTGTTATTGCAGATATTTTACCAGAAGAAAAAGCTGCACAAATTGCGAAACTACAGCAA
    CAAGGTAAGAAGGTTGCGATGGTTGGTGACGGTGTAAATGATGCACCTGCATTAGTTAAA
    GCTGATATCGGTATCGCCATTGGTACAGGTACAGAAGTTGCCATTGAAGCAGCTGATATT
    ACTATTCTTGGTGGCGACTTGATGCTTATTCCTAAAGCCATTTATGCAAGTAAAGCAACC
    ATTCGTAATATTCGTCAAAATCTATTTTGGGCATTCGGCTATAATATTGCCGGTATCCCT
    ATAGCTGCATTGGGCTTACTTGCGCCATGGGTTGCTGGTGCTGCAATGGCACTAAGTTCA
    GTAAGTGTTGTCACAAACGCACTTAGATTGAAAAAGATGCGATTAGAACCACGCCGTAAA
    GATGCCTAG
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380
    1440
    1500
    1560
    1620
    1680
    1740
    1800
    1860
    1920
    1980
    2040
    2100
    2160
    2220
    2280
    2340
    2400
    2409

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SAUSA300_2494 [new locus tag: SAUSA300_RS13855 ]
  • symbol: SAUSA300_2494
  • description: copper-translocating P-type ATPase
  • length: 802
  • theoretical pI: 6.08194
  • theoretical MW: 86769.8
  • GRAVY: 0.10985

Function[edit | edit source]

  • reaction:
    EC 3.6.3.54?  ExPASy
    Cu+ exporting ATPase ATP + H2O + Cu+(Side 1) = ADP + phosphate + Cu+(Side 2)
  • TIGRFAM:
    heavy metal translocating P-type ATPase (TIGR01525; EC 3.6.3.-; HMM-score: 670.8)
    Cellular processes Cellular processes Detoxification copper-translocating P-type ATPase (TIGR01511; EC 3.6.3.4; HMM-score: 632.8)
    Metabolism Transport and binding proteins Cations and iron carrying compounds copper-translocating P-type ATPase (TIGR01511; EC 3.6.3.4; HMM-score: 632.8)
    and 31 more
    Metabolism Transport and binding proteins Cations and iron carrying compounds cadmium-translocating P-type ATPase (TIGR01512; EC 3.6.3.3; HMM-score: 426.3)
    HAD ATPase, P-type, family IC (TIGR01494; EC 3.6.3.-; HMM-score: 325.4)
    Metabolism Transport and binding proteins Cations and iron carrying compounds K+-transporting ATPase, B subunit (TIGR01497; EC 3.6.3.12; HMM-score: 202.7)
    plasma-membrane proton-efflux P-type ATPase (TIGR01647; EC 3.6.3.6; HMM-score: 185.8)
    calcium-translocating P-type ATPase, PMCA-type (TIGR01517; EC 3.6.3.8; HMM-score: 159.7)
    calcium-transporting P-type ATPase, PMR1-type (TIGR01522; EC 3.6.3.8; HMM-score: 136.1)
    Metabolism Energy metabolism ATP-proton motive force interconversion Na,H/K antiporter P-type ATPase, alpha subunit (TIGR01106; EC 3.6.3.-; HMM-score: 134)
    Metabolism Transport and binding proteins Cations and iron carrying compounds calcium-translocating P-type ATPase, SERCA-type (TIGR01116; EC 3.6.3.8; HMM-score: 132)
    Metabolism Transport and binding proteins Cations and iron carrying compounds magnesium-translocating P-type ATPase (TIGR01524; EC 3.6.3.2; HMM-score: 105.5)
    P-type ATPase of unknown pump specificity (type V) (TIGR01657; HMM-score: 102.3)
    potassium/sodium efflux P-type ATPase, fungal-type (TIGR01523; EC 3.6.3.-; HMM-score: 100)
    Metabolism Transport and binding proteins Cations and iron carrying compounds copper ion binding protein (TIGR00003; HMM-score: 74.3)
    Cellular processes Cellular processes Detoxification mercuric transport protein periplasmic component (TIGR02052; HMM-score: 63.8)
    Unknown function Enzymes of unknown specificity Cof-like hydrolase (TIGR00099; HMM-score: 38.3)
    Metabolism Amino acid biosynthesis Serine family phosphoserine phosphatase SerB (TIGR00338; EC 3.1.3.3; HMM-score: 29.3)
    phospholipid-translocating P-type ATPase, flippase (TIGR01652; EC 3.6.3.1; HMM-score: 28.4)
    phosphoserine phosphatase-like hydrolase, archaeal (TIGR01491; HMM-score: 24.1)
    Cell structure Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides 3-deoxy-D-manno-octulosonate 8-phosphate phosphatase, YrbI family (TIGR01670; EC 3.1.3.45; HMM-score: 23.6)
    phosphoglycolate phosphatase, TA0175-type (TIGR01487; EC 3.1.3.18; HMM-score: 22.9)
    Unknown function Enzymes of unknown specificity HAD phosphoserine phosphatase-like hydrolase, family IB (TIGR01488; HMM-score: 21.3)
    sucrose-phosphate phosphatase subfamily (TIGR01482; EC 3.1.3.-; HMM-score: 19.2)
    mannosyl-3-phosphoglycerate phosphatase family (TIGR01486; EC 3.1.3.-; HMM-score: 19.1)
    phosphonatase-like hydrolase (TIGR03351; HMM-score: 18.5)
    HAD hydrolase, TIGR01548 family (TIGR01548; HMM-score: 14.8)
    Unknown function Enzymes of unknown specificity HAD hydrolase, family IB (TIGR01490; HMM-score: 13.1)
    Cellular processes Cellular processes Pathogenesis type III secretion apparatus lipoprotein, YscJ/HrcJ family (TIGR02544; HMM-score: 11.6)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking type III secretion apparatus lipoprotein, YscJ/HrcJ family (TIGR02544; HMM-score: 11.6)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Other Fe-S cluster assembly protein NifU (TIGR02000; HMM-score: 11.3)
    Metabolism Central intermediary metabolism Nitrogen fixation Fe-S cluster assembly protein NifU (TIGR02000; HMM-score: 11.3)
    Cellular processes Cellular processes Cell division chromosome segregation protein SMC (TIGR02169; HMM-score: 9.9)
    Genetic information processing DNA metabolism Chromosome-associated proteins chromosome segregation protein SMC (TIGR02169; HMM-score: 9.9)
  • TheSEED:  
    Protein Metabolism Protein biosynthesis Prolyl-tRNA synthetase associated editing enzymes  Copper-translocating P-type ATPase (EC 3.6.3.4)
    and 4 more
    Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) (EC 3.6.3.5)
    Respiration Electron accepting reactions Terminal cytochrome C oxidases  Copper-translocating P-type ATPase (EC 3.6.3.4)
    Virulence, Disease and Defense Resistance to antibiotics and toxic compounds Copper homeostasis  Copper-translocating P-type ATPase (EC 3.6.3.4)
    CBSS-196620.1.peg.2477  Copper-translocating P-type ATPase (EC 3.6.3.4)
  • PFAM:
    no clan defined E1-E2_ATPase; E1-E2 ATPase (PF00122; HMM-score: 192.8)
    HAD (CL0137) Hydrolase; haloacid dehalogenase-like hydrolase (PF00702; HMM-score: 168.9)
    and 8 more
    no clan defined HMA; Heavy-metal-associated domain (PF00403; HMM-score: 118.6)
    HAD (CL0137) Hydrolase_3; haloacid dehalogenase-like hydrolase (PF08282; HMM-score: 30.2)
    HAD; haloacid dehalogenase-like hydrolase (PF12710; HMM-score: 22.6)
    TusA-like (CL0397) TusA; Sulfurtransferase TusA (PF01206; HMM-score: 22.2)
    HAD (CL0137) Hydrolase_6; haloacid dehalogenase-like hydrolase (PF13344; HMM-score: 18.5)
    HAD_2; haloacid dehalogenase-like hydrolase (PF13419; HMM-score: 16.3)
    Zn_Beta_Ribbon (CL0167) OrfB_Zn_ribbon; Putative transposase DNA-binding domain (PF07282; HMM-score: 12.2)
    no clan defined DUF2207; Predicted membrane protein (DUF2207) (PF09972; HMM-score: 11.2)

Structure, modifications & interactions[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:
    SAUSA300_0760(eno)phosphopyruvate hydratase  [1] (data from MRSA252)
    SAUSA300_2187(rpsE)30S ribosomal protein S5  [1] (data from MRSA252)
    SAUSA300_0658LysR family transcriptional regulator  [1] (data from MRSA252)

Localization[edit | edit source]

  • PSORTb: Cytoplasmic Membrane
    • Cytoplasmic Score: 0
    • Cytoplasmic Membrane Score: 9.99
    • Cellwall Score: 0.01
    • Extracellular Score: 0.01
    • Internal Helices: 8
  • LocateP: Multi-transmembrane
    • Prediction by SwissProt Classification: Membrane
    • Pathway Prediction: Sec-(SPI)
    • Intracellular possibility: 0.17
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.017136
    • TAT(Tat/SPI): 0.000966
    • LIPO(Sec/SPII): 0.390678
  • predicted transmembrane helices (TMHMM): 8

Accession numbers[edit | edit source]

Protein sequence[edit | edit source]

  • MANTKKTTLDITGMTCAACSNRIEKKLNKLDDVNAQVNLTTEKATVEYNPDQHDVQEFINTIQHLGYGVAVETVELDITGMTCAACSSRIEKVLNKMDGVQNATVNLTTEQAKVDYYPEETDADKLVTRIQKLGYDASIKDNNKDQTSRKAEALQHKLIKLIISAVLSLPLLMLMFVHLFNMHIPALFTNPWFQFILATPVQFIIGWQFYVGAYKNLRNGGANMDVLVAVGTSAAYFYSIYEMVRWLNGSTTQPHLYFETSAVLITLILFGKYLEARAKSQTTNALGELLSLQAKEARILKDGNEVMIPLNEVHVGDTLIVKPGEKIPVDGKIIKGMTAIDESMLTGESIPVEKNVDDTVIGSTMNKNGTITMTATKVGGDTALANIIKVVEEAQSSKAPIQRLADIISGYFVPIVVGIALLTFIVWITLVTPGTFEPALVASISVLVIACPCALGLATPTSIMVGTGRAAENGILFKGGEFVERTHQIDTIVLDKTGTITNGRPVVTDYHGDNQTLQLLATAEKDSEHPLAEAIVNYAKEKQLILTETTTFKAVPGHGIEATIDHHYILVGNRKLMADNDISLPKHISDDLTHYERDGKTAMLIAVNYSLTGIIAVADTVKDHAKDAIKQLHDMGIEVAMLTGDNKNTAQAIAKQVGIDTVIADILPEEKAAQIAKLQQQGKKVAMVGDGVNDAPALVKADIGIAIGTGTEVAIEAADITILGGDLMLIPKAIYASKATIRNIRQNLFWAFGYNIAGIPIAALGLLAPWVAGAAMALSSVSVVTNALRLKKMRLEPRRKDA

Experimental data[edit | edit source]

  • experimentally validated: no data available

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

  • SAUSA300_2494 no polycistronic organisation predicted

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

  1. 1.0 1.1 1.2 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J Proteome Res: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

Relevant publications[edit | edit source]