From AureoWiki
Jump to navigation Jump to search

NCBI: 02-MAR-2017

Summary[edit | edit source]

  • organism: Staphylococcus aureus USA300_FPR3757
  • locus tag: SAUSA300_RS05315 [old locus tag: SAUSA300_0988 ]
  • pan locus tag?: SAUPAN003308000
  • symbol: SAUSA300_RS05315
  • pan gene symbol?: ktrA
  • synonym:
  • product: potassium transporter Trk

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SAUSA300_RS05315 [old locus tag: SAUSA300_0988 ]
  • symbol: SAUSA300_RS05315
  • product: potassium transporter Trk
  • replicon: chromosome
  • strand: +
  • coordinates: 1083412..1084074
  • length: 663
  • essential: unknown

Accession numbers[edit | edit source]

  • Location: NC_007793 (1083412..1084074) NCBI
  • BioCyc:
  • MicrobesOnline:

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    ATGGGTAAAGAATATGTAGTCATCGGTCTAGGTCGTTTTGGAGGTAGTATCGTTCGTGAG
    TTGAATGCATTAGACATGGATGTAATGGCCATCGACCATGATGAAAATAGAGTGAATGAA
    TATAGTGATATCGCTACTCATGCGGTTGTTGCAGACACTACAGATGAAGCAGTTATGAAA
    AGTTTAGGTATCCGTAACTTTGATCATGTCATTGTGGCAATTGGTGAAAATATTCAATCA
    AGTACGTTGACGACTTTAATTTTAAAAGAGTTAGGTGTAAAAAAAGTAACTGCTAAAGCA
    CAAAATGATTATCATGCAAAGATTTTAAATAAAATTGGAGCAGATACGGTTGTGCACCCT
    GAGCGTGATATGGGTAGACGTATTGCGCATAATGTTGCGAGTGCAAGTGTACTTGATTAT
    CTTGAGTTGGCAGACGAGCATTCTATTGTAGAATTGAAAGCAACTGAAAAGATGGCGGGG
    CAGTCTATCATTGATTTAGATATAAGAGCACAATATGGAATTAACATTATTGCAATTAAA
    CGAGGCAAAGAGTTCATCATTTCACCAAATCCAAATATTAATTTAGAAATAGGTGATATT
    TTAATCATGATTGGACATGATAATGATTTAAATCGCTTTGAAAAAAATATTGCGACGAGA
    TAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    663

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SAUSA300_RS05315 [old locus tag: SAUSA300_0988 ]
  • symbol: SAUSA300_RS05315
  • description: potassium transporter Trk
  • length: 220
  • theoretical pI: 5.32766
  • theoretical MW: 24282.6
  • GRAVY: -0.08

Function[edit | edit source]

  • TIGRFAM:
    aspartate-alanine antiporter (TIGR03802; HMM-score: 19.5)
    Metabolism Energy metabolism Pentose phosphate pathway 6-phosphogluconate dehydrogenase (decarboxylating) (TIGR00872; EC 1.1.1.44; HMM-score: 16.2)
    6-hydroxycyclohex-1-ene-1-carbonyl-CoA dehydrogenase (TIGR03201; EC 1.1.1.-; HMM-score: 16)
    and 5 more
    Metabolism Energy metabolism Amino acids and amines L-threonine 3-dehydrogenase (TIGR00692; EC 1.1.1.103; HMM-score: 15.1)
    Genetic information processing Protein fate Protein folding and stabilization xanthine dehydrogenase accessory protein XdhC (TIGR02964; HMM-score: 14.6)
    Metabolism Purines, pyrimidines, nucleosides, and nucleotides Other xanthine dehydrogenase accessory protein XdhC (TIGR02964; HMM-score: 14.6)
    Metabolism Purines, pyrimidines, nucleosides, and nucleotides Purine ribonucleotide biosynthesis phosphoribosylglycinamide formyltransferase 2 (TIGR01142; EC 2.1.2.-; HMM-score: 13.6)
    Unknown function Enzymes of unknown specificity putative quinone oxidoreductase, YhdH/YhfP family (TIGR02823; HMM-score: 13.2)
  • TheSEED:
  • PFAM:
    NADP_Rossmann (CL0063) TrkA_N; TrkA-N domain (PF02254; HMM-score: 104.5)
    and 9 more
    TrkA_C (CL0582) TrkA_C; TrkA-C domain (PF02080; HMM-score: 54.6)
    NADP_Rossmann (CL0063) ADH_zinc_N; Zinc-binding dehydrogenase (PF00107; HMM-score: 22.9)
    NAD_binding_2; NAD binding domain of 6-phosphogluconate dehydrogenase (PF03446; HMM-score: 21.7)
    2-Hacid_dh_C; D-isomer specific 2-hydroxyacid dehydrogenase, NAD binding domain (PF02826; HMM-score: 20.5)
    F420_oxidored; NADP oxidoreductase coenzyme F420-dependent (PF03807; HMM-score: 16.9)
    Epimerase; NAD dependent epimerase/dehydratase family (PF01370; HMM-score: 15.6)
    NmrA; NmrA-like family (PF05368; HMM-score: 14)
    XdhC_C; XdhC Rossmann domain (PF13478; HMM-score: 13.6)
    AlaDh_PNT_C; Alanine dehydrogenase/PNT, C-terminal domain (PF01262; HMM-score: 11.9)

Structure, modifications & interactions[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.005879
    • TAT(Tat/SPI): 0.000288
    • LIPO(Sec/SPII): 0.000607
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

  • GI: 446436435 NCBI
  • RefSeq: WP_000514290 NCBI
  • UniProt:

Protein sequence[edit | edit source]

  • MGKEYVVIGLGRFGGSIVRELNALDMDVMAIDHDENRVNEYSDIATHAVVADTTDEAVMKSLGIRNFDHVIVAIGENIQSSTLTTLILKELGVKKVTAKAQNDYHAKILNKIGADTVVHPERDMGRRIAHNVASASVLDYLELADEHSIVELKATEKMAGQSIIDLDIRAQYGINIIAIKRGKEFIISPNPNINLEIGDILIMIGHDNDLNRFEKNIATR

Experimental data[edit | edit source]

  • experimentally validated: no data available

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

Relevant publications[edit | edit source]