From AureoWiki
Jump to navigation Jump to search

NCBI: 02-MAR-2017

⊟Summary[edit | edit source]

  • organism: Staphylococcus aureus USA300_FPR3757
  • locus tag: SAUSA300_RS13155 [old locus tag: SAUSA300_2378 ]
  • pan locus tag?: SAUPAN005981000
  • symbol: SAUSA300_RS13155
  • pan gene symbol?: —
  • synonym:
  • product: membrane protein

⊟Genome View[edit | edit source]

⊟Gene[edit | edit source]

⊟General[edit | edit source]

  • type: CDS
  • locus tag: SAUSA300_RS13155 [old locus tag: SAUSA300_2378 ]
  • symbol: SAUSA300_RS13155
  • product: membrane protein
  • replicon: chromosome
  • strand: +
  • coordinates: 2557604..2558263
  • length: 660
  • essential: unknown other strains

⊟Accession numbers[edit | edit source]

⊟Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

⊟DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    ATGAAAAGAACTGATAAATACCGTGATTCATATCAATACGACAATCAAAACCAAAATCAT
    CGTCGTCAATCTGAAGACGCATCGTATAGACAACAATATGCTAAAGGCGATCCTGAAGAA
    CACCCGGAACGATACTATAATGGTAGAGATTATCGAAGAGAACAAATTCTTGAAGAAGAA
    AACGAGAAATCCCGCCGTTCAAAAAAATGGTTATATATCATTATTGCCATTCTCTTAATT
    ATTGTCGCTATTTTTGTCACACGCGCCTTACTTAACAATGATAGCGATAAAGTTAGTAAT
    GACCCTAAAGTCTCTCAAAATTATAAAAAACAAGTTGAAAATCAAGACGGCCAAATTAAC
    CAGCAAGTAGATAATGCTAAAGAAAATATTAAAAACAACCAAAAAACTGATGACATTATT
    AAAAATTTACAAAATCAAATCGACAACTTGAAGCAGCAAGAACAAAACAAAGCTGATTCT
    AAGCTAACTCAATTTTATCAAGACCAAATCAACAAATTGACAGAGGCAAATAATGCACTT
    AAAAACAATGCAAGCCAAGGTAAAATTGAAAGCATGTTAAATGATATTAATACAAAATTC
    GACAGTATTAAATCTAAATTAGAAAGCTTATTTAAAGATGACAATGGTGGCGCTAATTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660

⊟Protein[edit | edit source]

⊟General[edit | edit source]

  • locus tag: SAUSA300_RS13155 [old locus tag: SAUSA300_2378 ]
  • symbol: SAUSA300_RS13155
  • description: membrane protein
  • length: 219
  • theoretical pI: 8.61585
  • theoretical MW: 25799.2
  • GRAVY: -1.38402

⊟Function[edit | edit source]

  • TIGRFAM:
    TIGR03943 family protein (TIGR03943; HMM-score: 15.1)
    Genetic information processing Protein fate Protein folding and stabilization cytochrome c-type biogenesis protein CcmI (TIGR03142; HMM-score: 14.6)
    Metabolism Energy metabolism Electron transport cytochrome c-type biogenesis protein CcmI (TIGR03142; HMM-score: 14.6)
    Metabolism Transport and binding proteins Carbohydrates, organic alcohols, and acids PTS system, glucose-specific IIBC component (TIGR02002; EC 2.7.1.69; HMM-score: 13.7)
    and 11 more
    Cellular processes Cellular processes Pathogenesis type IV/VI secretion system protein, DotU family (TIGR03349; HMM-score: 11.6)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking type IV/VI secretion system protein, DotU family (TIGR03349; HMM-score: 11.6)
    Cellular processes Cellular processes Toxin production and resistance thiopeptide-type bacteriocin biosynthesis domain (TIGR03891; HMM-score: 11.1)
    Hypothetical proteins Conserved TIGR00366 family protein (TIGR00366; HMM-score: 10.5)
    Metabolism Transport and binding proteins Carbohydrates, organic alcohols, and acids D-galactonate transporter (TIGR00893; HMM-score: 10)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Other C-3',4' desaturase CrtD (TIGR02733; EC 1.3.99.-; HMM-score: 10)
    conjugal transfer/type IV secretion protein DotA/TraY (TIGR04346; HMM-score: 9.1)
    phage lysis regulatory protein, LysB family (TIGR03495; HMM-score: 5.6)
    two transmembrane protein (TIGR04527; HMM-score: 4.7)
    Cellular processes Cellular processes Pathogenesis type III secretion apparatus protein, YscR/HrcR family (TIGR01102; HMM-score: 4)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking type III secretion apparatus protein, YscR/HrcR family (TIGR01102; HMM-score: 4)
  • TheSEED: see SAUSA300_2378
  • PFAM:
    no clan defined DUF1510; Protein of unknown function (DUF1510) (PF07423; HMM-score: 26.3)
    and 28 more
    FRB_dom; FKBP12-rapamycin binding domain (PF08771; HMM-score: 20)
    Med9; RNA polymerase II transcription mediator complex subunit 9 (PF07544; HMM-score: 18.3)
    Peptidase_MA (CL0126) DUF3810; Protein of unknown function (DUF3810) (PF12725; HMM-score: 17.5)
    no clan defined GlutR_dimer; Glutamyl-tRNAGlu reductase, dimerisation domain (PF00745; HMM-score: 17.3)
    Amnionless; Amnionless (PF14828; HMM-score: 16.9)
    ATP_synthase (CL0255) ATP-synt_B; ATP synthase B/B' CF(0) (PF00430; HMM-score: 16.3)
    no clan defined SNARE; SNARE domain (PF05739; HMM-score: 16.2)
    DUF4094; Domain of unknown function (DUF4094) (PF13334; HMM-score: 16.2)
    DUF2408; Protein of unknown function (DUF2408) (PF10303; HMM-score: 14.3)
    DUF4446; Protein of unknown function (DUF4446) (PF14584; HMM-score: 14.2)
    MFS (CL0015) MFS_Mycoplasma; Mycoplasma MFS transporter (PF07672; HMM-score: 14.1)
    ABC-2 (CL0181) ABC2_membrane_3; ABC-2 family transporter protein (PF12698; HMM-score: 14)
    no clan defined DUF948; Bacterial protein of unknown function (DUF948) (PF06103; HMM-score: 13.7)
    ATP_synthase (CL0255) HrpE; HrpE/YscL/FliH and V-type ATPase subunit E (PF06188; HMM-score: 12.5)
    PepSY_TM-like (CL0490) PepSY_TM_like_2; Putative PepSY_TM-like (PF16357; HMM-score: 12.5)
    no clan defined SARAF; SOCE-associated regulatory factor of calcium homoeostasis (PF06682; HMM-score: 12.2)
    ABC-2 (CL0181) ABC2_membrane_2; ABC-2 family transporter protein (PF12679; HMM-score: 11.7)
    Zn_Beta_Ribbon (CL0167) DUF2116; Uncharacterized protein containing a Zn-ribbon (DUF2116) (PF09889; HMM-score: 11.6)
    GPCR_A (CL0192) SID-1_RNA_chan; dsRNA-gated channel SID-1 (PF13965; HMM-score: 11.5)
    IT (CL0182) SCFA_trans; Short chain fatty acid transporter (PF02667; HMM-score: 10.5)
    no clan defined YtxH; YtxH-like protein (PF12732; HMM-score: 10.1)
    FUN14; FUN14 family (PF04930; HMM-score: 9.7)
    SapB_1; Saposin-like type B, region 1 (PF05184; HMM-score: 8.9)
    DUF5469; Family of unknown function (DUF5469) (PF17561; HMM-score: 8.3)
    PP2C_C; Protein serine/threonine phosphatase 2C, C-terminal domain (PF07830; HMM-score: 7.3)
    DUF3899; Domain of unknown function (DUF3899) (PF13038; HMM-score: 7.2)
    Not1; CCR4-Not complex component, Not1 (PF04054; HMM-score: 7.1)
    Vma12; Endoplasmic reticulum-based factor for assembly of V-ATPase (PF11712; HMM-score: 6.8)

⊟Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

⊟Localization[edit | edit source]

  • PSORTb: unknown (no significant prediction)
    • Cytoplasmic Score: 2.5
    • Cytoplasmic Membrane Score: 2.5
    • Cellwall Score: 2.5
    • Extracellular Score: 2.5
    • Internal Helix: 1
  • LocateP:
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.023157
    • TAT(Tat/SPI): 0.00401
    • LIPO(Sec/SPII): 0.008892
  • predicted transmembrane helices (TMHMM): 1

⊟Accession numbers[edit | edit source]

⊟Protein sequence[edit | edit source]

  • MKRTDKYRDSYQYDNQNQNHRRQSEDASYRQQYAKGDPEEHPERYYNGRDYRREQILEEENEKSRRSKKWLYIIIAILLIIVAIFVTRALLNNDSDKVSNDPKVSQNYKKQVENQDGQINQQVDNAKENIKNNQKTDDIIKNLQNQIDNLKQQEQNKADSKLTQFYQDQINKLTEANNALKNNASQGKIESMLNDINTKFDSIKSKLESLFKDDNGGAN

⊟Experimental data[edit | edit source]

  • experimentally validated: data available for COL, NCTC8325
  • protein localization: data available for COL
  • quantitative data / protein copy number per cell: data available for COL
  • interaction partners:

⊟Expression & Regulation[edit | edit source]

⊟Operon[edit | edit source]

⊟Regulation[edit | edit source]

  • regulator:

⊟Transcription pattern[edit | edit source]

⊟Protein synthesis (provided by Aureolib)[edit | edit source]

⊟Protein stability[edit | edit source]

  • half-life: no data available

⊟Biological Material[edit | edit source]

⊟Mutants[edit | edit source]

⊟Expression vector[edit | edit source]

⊟lacZ fusion[edit | edit source]

⊟GFP fusion[edit | edit source]

⊟two-hybrid system[edit | edit source]

⊟FLAG-tag construct[edit | edit source]

⊟Antibody[edit | edit source]

⊟Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

⊟Literature[edit | edit source]

⊟References[edit | edit source]

⊟Relevant publications[edit | edit source]

Retrieved from "http://aureowiki.med.uni-greifswald.de/index.php?title=SAUSA300_RS13155&oldid=92338"