From AureoWiki
Jump to navigation Jump to search
COLN315NCTC8325NewmanUSA300_FPR375704-0298108BA0217611819-97685071193ECT-R 2ED133ED98HO 5096 0412JH1JH9JKD6008JKD6159LGA251M013MRSA252MSHR1132MSSA476MW2Mu3Mu50RF122ST398T0131TCH60TW20USA300_TCH1516VC40

NCBI: 02-MAR-2017

Summary[edit | edit source]

  • organism: Staphylococcus aureus USA300_FPR3757
  • locus tag: SAUSA300_RS14830 [old locus tag: SAUSA300_pUSA030019 ]
  • pan locus tag?:
  • symbol: SAUSA300_RS14830
  • pan gene symbol?:
  • synonym:
  • product: hypothetical protein

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SAUSA300_RS14830 [old locus tag: SAUSA300_pUSA030019 ]
  • symbol: SAUSA300_RS14830
  • product: hypothetical protein
  • replicon: pUSA03
  • strand: +
  • coordinates: 19532..19996
  • length: 465
  • essential: unknown

Accession numbers[edit | edit source]

  • Location: NC_007792 (19532..19996) NCBI
  • BioCyc:
  • MicrobesOnline:

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    GTGAAAAAAGGAATATTCATTTTAACTGGTATTATTTGGCTAGTATTAATATATTTAGCG
    CAAATATTAGCATATGCTTTAAATACACTAAGTAATACTAGCAATAAGCAAAAGATATTT
    AGTGATATATCACAGTTGTTTATACCTCCAGCTAAACACCCAATAAGCACTATTATCGGT
    TTTGTATCTGATAAAAATACAGTGTTTTTTGTAATAGGTGTAATAGCAACAATTATTTGT
    ATATATATTCTTATAAAACAATTATTTGAGAGCAAAGACGGAAACGAAAAAAATCAAGAC
    TATAAAATTGCTAAACATGGTTCTCATGGATCAGCTAAATTTGCCGAAGATAGCGAATTG
    TTTTCAGAAGGACATTATAAAAAAATGAAAGAAAACGACATTACGAACTATGTTTATAAC
    AGTTTAGATAAATCATTAATAGAAGAAAGAAGTGATAAGGAATGA
    60
    120
    180
    240
    300
    360
    420
    465

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SAUSA300_RS14830 [old locus tag: SAUSA300_pUSA030019 ]
  • symbol: SAUSA300_RS14830
  • description: hypothetical protein
  • length: 154
  • theoretical pI: 8.40965
  • theoretical MW: 17469.1
  • GRAVY: -0.0435065

Function[edit | edit source]

  • TIGRFAM:
    Unknown function General heme biosynthesis-associated TPR protein (TIGR00540; HMM-score: 12.1)
    integral membrane protein (TIGR04561; HMM-score: 11.7)
  • TheSEED:
  • PFAM:
    no clan defined CrgA; Cell division protein CrgA (PF06781; HMM-score: 12.2)
    DUF4834; Domain of unknown function (DUF4834) (PF16118; HMM-score: 11.4)
    Tetraspannin (CL0347) DUF4064; Protein of unknown function (DUF4064) (PF13273; HMM-score: 11.3)
    no clan defined SPC12; Microsomal signal peptidase 12 kDa subunit (SPC12) (PF06645; HMM-score: 11.1)
    Rab5ip; Rab5-interacting protein (Rab5ip) (PF07019; HMM-score: 10.6)
    and 1 more
    LMBR1; LMBR1-like membrane protein (PF04791; HMM-score: 9.7)

Structure, modifications & interactions[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic Membrane
    • Cytoplasmic Score: 0.32
    • Cytoplasmic Membrane Score: 9.55
    • Cellwall Score: 0.12
    • Extracellular Score: 0.01
    • Internal Helices: 2
  • LocateP:
  • SignalP: Signal peptide SP(Sec/SPI) length 26 aa
    • SP(Sec/SPI): 0.750432
    • TAT(Tat/SPI): 0.013522
    • LIPO(Sec/SPII): 0.019447
    • Cleavage Site: CS pos: 26-27. AYA-LN. Pr: 0.6184
  • predicted transmembrane helices (TMHMM): 2

Accession numbers[edit | edit source]

  • GI: 446637927 NCBI
  • RefSeq: WP_000715273 NCBI
  • UniProt:

Protein sequence[edit | edit source]

  • MKKGIFILTGIIWLVLIYLAQILAYALNTLSNTSNKQKIFSDISQLFIPPAKHPISTIIGFVSDKNTVFFVIGVIATIICIYILIKQLFESKDGNEKNQDYKIAKHGSHGSAKFAEDSELFSEGHYKKMKENDITNYVYNSLDKSLIEERSDKE

Experimental data[edit | edit source]

  • experimentally validated: no data available

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

Relevant publications[edit | edit source]