From AureoWiki
Jump to navigation Jump to search

NCBI: 02-MAR-2017

Summary[edit | edit source]

  • organism: Staphylococcus aureus N315
  • locus tag: SA_RS03430 [old locus tag: SA0597 ]
  • pan locus tag?: SAUPAN002518000
  • symbol: SA_RS03430
  • pan gene symbol?: tagD
  • synonym:
  • product: glycerol-3-phosphate cytidylyltransferase

Additional information (user-provided)[edit | edit source]

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SA_RS03430 [old locus tag: SA0597 ]
  • symbol: SA_RS03430
  • product: glycerol-3-phosphate cytidylyltransferase
  • replicon: chromosome
  • strand: +
  • coordinates: 690173..690571
  • length: 399
  • essential: no DEG other strains

Accession numbers[edit | edit source]

  • Location: NC_002745 (690173..690571) NCBI
  • BioCyc: SA_RS03430 BioCyc
  • MicrobesOnline: see SA0597

Phenotype[edit | edit source]

Additional information (user-provided)[edit | edit source]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    ATGAAACGTGTAATAACATATGGCACATATGACTTACTTCACTATGGTCATATCGAATTG
    CTTCGTCGTGCAAGAGAGATGGGCGATTATTTAATAGTAGCATTATCAACAGATGAATTT
    AATCAAATTAAACATAAAAAATCTTATTATGATTATGAACAACGAAAAATGATGCTTGAA
    TCAATACGCTATGTCGATTTAGTCATTCCAGAAAAGGGCTGGGGACAAAAAGAAGACGAT
    GTCGAAAAATTTGATGTAGATGTTTTTGTTATGGGACATGACTGGGAAGGTGAATTCGAC
    TTCTTAAAGGATAAATGTGAAGTCATTTATTTAAAACGTACAGAAGGCATTTCGACGACT
    AAAATCAAACAAGAATTATATGGTAAAGATGCTAAATAA
    60
    120
    180
    240
    300
    360
    399


Protein[edit | edit source]

Protein Data Bank: 2B7L

General[edit | edit source]

  • locus tag: SA_RS03430 [old locus tag: SA0597 ]
  • symbol: SA_RS03430
  • description: glycerol-3-phosphate cytidylyltransferase
  • length: 132
  • theoretical pI: 5.69067
  • theoretical MW: 15817
  • GRAVY: -0.660606

Function[edit | edit source]

  • TIGRFAM:
    Cell structure Cell envelope Biosynthesis and degradation of murein sacculus and peptidoglycan glycerol-3-phosphate cytidylyltransferase (TIGR01518; EC 2.7.7.39; HMM-score: 201)
    and 5 more
    cytidyltransferase-like domain (TIGR00125; HMM-score: 77.8)
    Cell structure Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides bifunctional protein RfaE, domain II (TIGR02199; EC 2.7.7.-; HMM-score: 61.5)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Pantothenate and coenzyme A pantetheine-phosphate adenylyltransferase (TIGR01510; EC 2.7.7.3; HMM-score: 29.9)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Pyridine nucleotides nicotinate (nicotinamide) nucleotide adenylyltransferase (TIGR00482; EC 2.7.7.18; HMM-score: 15.2)
    nicotinamide-nucleotide adenylyltransferase (TIGR01526; EC 2.7.7.1; HMM-score: 13.8)
  • TheSEED: see SA0597
  • PFAM:
    HUP (CL0039) CTP_transf_like; Cytidylyltransferase-like (PF01467; HMM-score: 96.4)
    and 3 more
    FAD_syn; FAD synthetase (PF06574; HMM-score: 18.5)
    Pantoate_ligase; Pantoate-beta-alanine ligase (PF02569; HMM-score: 14.6)
    HIGH_NTase1_ass; Cytidyltransferase-related C-terminal region (PF16581; HMM-score: 13.1)

Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • DeepLocPro: Cytoplasmic
    • Cytoplasmic Score: 0.9933
    • Cytoplasmic Membrane Score: 0.0002
    • Cell wall & surface Score: 0
    • Extracellular Score: 0.0065
  • LocateP:
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.003818
    • TAT(Tat/SPI): 0.00017
    • LIPO(Sec/SPII): 0.000723
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

Additional information (user-provided)[edit | edit source]

Protein sequence[edit | edit source]

  • MKRVITYGTYDLLHYGHIELLRRAREMGDYLIVALSTDEFNQIKHKKSYYDYEQRKMMLESIRYVDLVIPEKGWGQKEDDVEKFDVDVFVMGHDWEGEFDFLKDKCEVIYLKRTEGISTTKIKQELYGKDAK

Experimental data[edit | edit source]

  • experimentally validated: data available for COL, NCTC8325
  • protein localization: data available for COL
  • quantitative data / protein copy number per cell: data available for COL
  • interaction partners:
    SA_RS02960elongation factor Tu  [1] (data from MRSA252)
    SA_RS04895NAD(+) kinase  [1] (data from MRSA252)
    SA_RS05350pyruvate dehydrogenase E1 component subunit alpha  [1] (data from MRSA252)
    SA_RS05355pyruvate dehydrogenase E1 component subunit beta  [1] (data from MRSA252)
    SA_RS05360dihydrolipoyllysine-residue acetyltransferase component of pyruvate dehydrogenase complex  [1] (data from MRSA252)

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Additional information (user-provided)[edit | edit source]

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Additional information (user-provided)[edit | edit source]

Other information (user-provided)[edit | edit source]

You can add further information about the gene and protein here. [edit]

Literature[edit | edit source]

References[edit | edit source]

  1. 1.0 1.1 1.2 1.3 1.4 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J Proteome Res: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

Relevant publications[edit | edit source]