From AureoWiki
Jump to navigation Jump to search

NCBI: 02-MAR-2017

Summary[edit | edit source]

  • organism: Staphylococcus aureus N315
  • locus tag: SA_RS06335 [old locus tag: SA1120 ]
  • pan locus tag?: SAUPAN003578000
  • symbol: SA_RS06335
  • pan gene symbol?:
  • synonym:
  • product: GntR family transcriptional regulator

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SA_RS06335 [old locus tag: SA1120 ]
  • symbol: SA_RS06335
  • product: GntR family transcriptional regulator
  • replicon: chromosome
  • strand: +
  • coordinates: 1273076..1273789
  • length: 714
  • essential: unknown

Accession numbers[edit | edit source]

  • Location: NC_002745 (1273076..1273789) NCBI
  • BioCyc: G1G21-1277 BioCyc
  • MicrobesOnline:

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    ATGTCAGAAATGAATGCGGTATATAACGTTAAACAATACATTTTAAATTTGATTATGCAA
    AATAAATTGGAATATGGTGACCAACTTCCAAGTAATTTATCAATTGCCAGAGAATTAAAT
    GTAAAAACCGACGATGTTTATGAAGCAATTCAGGCATTGATTACTGAACAAGTCATTAAA
    GATAATTTTGAAGAGGGCACAAGTGTTAAATCACTGCCCCCTTTCTTTTATCCATTGAAT
    GAACTTATAAGTATTGGGCAAATGATTAAAAATGCAGGATTTGAATGCGGAACTGAATAC
    TTAAATTTTGATGAGCAACCAGCAACTATGTTAGATGCAAATTTGTTGAGCGTTGAAGAA
    GGATATCCAGTAACCATTATAGAACGATTACGAACTGCCGATGGAGAACCGGTCGTCTAT
    TGTTTAGATAAAATTGCTAAAAAAGAATTAACATGTACAGAGTATCAAATGAGCAATGGA
    TCGATACTAAGTGCGATAAAAGAACAAAGTAATCATAATATTTGTTACGCTGATACAGAA
    ATTGAAGCGGTAAATTATGAACCTCGAATATCCGAAGTACTGAATGCTTCGCCACACGAA
    GGTTTGATTTTATTAAAAATTACGCACTACAATGAATTAGATGAACCTATTTTGTATTCA
    TTAAATTATATGAAAAATAGCTTAGTTCAATTTAAAATCACTAGAAAAATATAG
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    714

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SA_RS06335 [old locus tag: SA1120 ]
  • symbol: SA_RS06335
  • description: GntR family transcriptional regulator
  • length: 237
  • theoretical pI: 4.28223
  • theoretical MW: 26979.6
  • GRAVY: -0.223629

Function[edit | edit source]

  • TIGRFAM:
    Metabolism Transport and binding proteins Anions phosphonate metabolism transcriptional regulator PhnF (TIGR02325; HMM-score: 74.3)
    Signal transduction Regulatory functions DNA interactions phosphonate metabolism transcriptional regulator PhnF (TIGR02325; HMM-score: 74.3)
    Signal transduction Regulatory functions DNA interactions trehalose operon repressor (TIGR02404; HMM-score: 65)
    and 3 more
    Signal transduction Regulatory functions DNA interactions phosphonate utilization transcriptional regulator PhnR (TIGR03337; HMM-score: 51.1)
    Metabolism Energy metabolism Amino acids and amines histidine utilization repressor (TIGR02018; HMM-score: 28.1)
    Signal transduction Regulatory functions DNA interactions histidine utilization repressor (TIGR02018; HMM-score: 28.1)
  • TheSEED:
  • PFAM:
    UTRA (CL0122) UTRA; UTRA domain (PF07702; HMM-score: 93.5)
    and 2 more
    HTH (CL0123) GntR; Bacterial regulatory proteins, gntR family (PF00392; HMM-score: 33)
    no clan defined IFT57; Intra-flagellar transport protein 57 (PF10498; HMM-score: 15)

Structure, modifications & interactions[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit | edit source]

  • PSORTb: unknown (no significant prediction)
    • Cytoplasmic Score: 2.5
    • Cytoplasmic Membrane Score: 2.5
    • Cellwall Score: 2.5
    • Extracellular Score: 2.5
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.003847
    • TAT(Tat/SPI): 0.000107
    • LIPO(Sec/SPII): 0.000341
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

  • GI: 447216056 NCBI
  • RefSeq: WP_001293312 NCBI
  • UniProt:

Protein sequence[edit | edit source]

  • MSEMNAVYNVKQYILNLIMQNKLEYGDQLPSNLSIARELNVKTDDVYEAIQALITEQVIKDNFEEGTSVKSLPPFFYPLNELISIGQMIKNAGFECGTEYLNFDEQPATMLDANLLSVEEGYPVTIIERLRTADGEPVVYCLDKIAKKELTCTEYQMSNGSILSAIKEQSNHNICYADTEIEAVNYEPRISEVLNASPHEGLILLKITHYNELDEPILYSLNYMKNSLVQFKITRKI

Experimental data[edit | edit source]

  • experimentally validated: no data available

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

Relevant publications[edit | edit source]