From AureoWiki
Jump to navigation Jump to search

NCBI: 02-MAR-2017

Summary[edit | edit source]

  • organism: Staphylococcus aureus N315
  • locus tag: SA_RS07395 [old locus tag: SA1307 ]
  • pan locus tag?: SAUPAN003936000
  • symbol: SA_RS07395
  • pan gene symbol?: engA
  • synonym:
  • product: ribosome biogenesis GTPase Der

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SA_RS07395 [old locus tag: SA1307 ]
  • symbol: SA_RS07395
  • product: ribosome biogenesis GTPase Der
  • replicon: chromosome
  • strand: -
  • coordinates: 1512168..1513478
  • length: 1311
  • essential: unknown

Accession numbers[edit | edit source]

  • Location: NC_002745 (1512168..1513478) NCBI
  • BioCyc: G1G21-1490 BioCyc
  • MicrobesOnline:

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    ATGACTAAACCTATAGTAGCTATTGTAGGTAGGCCTAATGTAGGTAAATCTACAATTTTT
    AATAGAATAGTTGGAGAACGTGTTTCGATTGTGGAAGACACGCCAGGTGTAACACGAGAT
    CGTATTTATTCTTCAGGTGAATGGTTAACACATGATTTCAATATTATTGATACAGGTGGT
    ATTGAAATTGGTGATGCACCATTCCAAACACAAATTAGAGCGCAGGCAGAAATCGCCATA
    GATGAAGCGGATGTTATTATTTTTATGGTTAACGTGCGTGAAGGATTGACACAAAGCGAT
    GAAATGGTCGCTCAAATTTTATACAAATCTAAAAAACCGGTCGTATTAGCGGTTAACAAA
    GTAGATAATATGGAAATGCGTACAGACGTGTATGATTTCTATTCATTAGGATTTGGTGAA
    CCGTATCCGATATCAGGGTCACATGGTTTAGGTCTTGGTGACTTGTTAGATGCAGTTGTT
    TCTCATTTTGGTGAAGAGGAAGAAGATCCTTATGATGAAGATACAATTCGACTATCCATT
    ATTGGACGACCAAACGTAGGTAAATCAAGTTTAGTAAATGCTATTTTAGGTGAAGATCGC
    GTTATCGTTTCTAATGTTGCAGGGACAACGAGAGACGCTATTGATACAGAGTATAGTTAT
    GATGGACAAGATTATGTTTTAATCGATACTGCTGGTATGCGTAAAAAAGGAAAAGTATAT
    GAATCAACTGAGAAATATTCAGTACTAAGAGCTTTAAAAGCGATTGAACGTTCAAATGTT
    GTTTTAGTGGTCATTGATGCAGAACAAGGCATCATTGAACAAGATAAACGTGTTGCAGGA
    TATGCACATGAACAAGGTAAAGCAGTCGTGATTGTCGTAAATAAATGGGATACTGTGGAA
    AAAGATAGTAAAACGATGAAGAAATTTGAAGATGAAGTACGTAAAGAATTCCAATTTTTA
    GATTATGCACAAATTGCTTTTGTGTCTGCTAAAGAACGCACAAGATTACGTACATTATTC
    CCTTACATTAATGAAGCAAGTGAAAACCATAAAAAACGTGTTCAAAGTTCAACTTTAAAT
    GAAGTTGTTACTGATGCAATTTCCATGAACCCTACACCAACAGACAAAGGTAGACGTTTG
    AATGTCTTTTATGCAACACAAGTTGCTATAGAACCACCGACATTTGTTGTATTTGTTAAT
    GATGTAGAATTAATGCATTTTTCTTATAAACGCTATTTAGAGAATCAAATCCGTGCCGCT
    TTTGGTTTTGAAGGTACACCAATTCATATTATAGCTCGAAAGAGAAATTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1311

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SA_RS07395 [old locus tag: SA1307 ]
  • symbol: SA_RS07395
  • description: ribosome biogenesis GTPase Der
  • length: 436
  • theoretical pI: 5.0013
  • theoretical MW: 48979.2
  • GRAVY: -0.271789

Function[edit | edit source]

  • TIGRFAM:
    Genetic information processing Protein synthesis Other ribosome-associated GTPase EngA (TIGR03594; HMM-score: 605.2)
    and 29 more
    Genetic information processing Protein synthesis tRNA and rRNA base modification tRNA modification GTPase TrmE (TIGR00450; EC 3.6.-.-; HMM-score: 181.9)
    Unknown function General small GTP-binding protein domain (TIGR00231; HMM-score: 175.3)
    Genetic information processing Protein synthesis Other GTP-binding protein Era (TIGR00436; HMM-score: 167.4)
    Genetic information processing Protein fate Protein modification and repair [FeFe] hydrogenase H-cluster maturation GTPase HydF (TIGR03918; HMM-score: 153.1)
    Genetic information processing Protein synthesis Other ribosome biogenesis GTP-binding protein YlqF (TIGR03596; HMM-score: 109.7)
    Genetic information processing Protein synthesis Other ribosome biogenesis GTP-binding protein YsxC (TIGR03598; HMM-score: 100.6)
    Metabolism Transport and binding proteins Cations and iron carrying compounds ferrous iron transport protein B (TIGR00437; HMM-score: 92.3)
    Genetic information processing Protein synthesis Other ribosome biogenesis GTPase YqeH (TIGR03597; HMM-score: 66.2)
    Unknown function General GTP-binding protein HflX (TIGR03156; HMM-score: 61.2)
    Genetic information processing Protein synthesis Other Obg family GTPase CgtA (TIGR02729; HMM-score: 43.9)
    Genetic information processing Protein synthesis Translation factors ribosome small subunit-dependent GTPase A (TIGR00157; EC 3.6.-.-; HMM-score: 39.3)
    Metabolism Central intermediary metabolism Sulfur metabolism sulfate adenylyltransferase, large subunit (TIGR02034; EC 2.7.7.4; HMM-score: 37.4)
    Metabolism Transport and binding proteins Nucleosides, purines and pyrimidines GTP-binding protein (TIGR00991; HMM-score: 36.2)
    Cellular processes Cellular processes Adaptations to atypical conditions GTP-binding protein TypA/BipA (TIGR01394; HMM-score: 33.6)
    Genetic information processing Protein synthesis Translation factors GTP-binding protein TypA/BipA (TIGR01394; HMM-score: 33.6)
    Signal transduction Regulatory functions Other GTP-binding protein TypA/BipA (TIGR01394; HMM-score: 33.6)
    Genetic information processing Protein synthesis Translation factors translation initiation factor IF-2 (TIGR00487; HMM-score: 32.9)
    Unknown function General GTP-binding protein YchF (TIGR00092; HMM-score: 27.5)
    Unknown function General elongation factor 4 (TIGR01393; EC 3.6.5.-; HMM-score: 26)
    Metabolism Purines, pyrimidines, nucleosides, and nucleotides Nucleotide and nucleoside interconversions guanylate kinase (TIGR03263; EC 2.7.4.8; HMM-score: 24.4)
    Metabolism Transport and binding proteins Amino acids, peptides and amines chloroplast protein import component Toc86/159, G and M domains (TIGR00993; HMM-score: 23.6)
    Genetic information processing Protein synthesis Translation factors translation initiation factor aIF-2 (TIGR00491; HMM-score: 18.7)
    Metabolism Energy metabolism Amino acids and amines ethanolamine utilization protein, EutP (TIGR02528; HMM-score: 18.2)
    Metabolism Transport and binding proteins Amino acids, peptides and amines urea ABC transporter, ATP-binding protein UrtE (TIGR03410; HMM-score: 17)
    Metabolism Transport and binding proteins Amino acids, peptides and amines LAO/AO transport system ATPase (TIGR00750; EC 2.7.-.-; HMM-score: 12.9)
    Signal transduction Regulatory functions Protein interactions LAO/AO transport system ATPase (TIGR00750; EC 2.7.-.-; HMM-score: 12.9)
    Genetic information processing Protein fate Protein modification and repair hydrogenase accessory protein HypB (TIGR00073; HMM-score: 12.5)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Pantothenate and coenzyme A dephospho-CoA kinase (TIGR00152; EC 2.7.1.24; HMM-score: 11.4)
    translation initiation factor 2, gamma subunit (TIGR03680; HMM-score: 11)
  • TheSEED:
  • PFAM:
    P-loop_NTPase (CL0023) MMR_HSR1; 50S ribosome-binding GTPase (PF01926; HMM-score: 186.1)
    and 31 more
    no clan defined KH_dom-like; KH-domain-like of EngA bacterial GTPase enzymes, C-terminal (PF14714; HMM-score: 113.6)
    P-loop_NTPase (CL0023) FeoB_N; Ferrous iron transport protein B (PF02421; HMM-score: 103.6)
    GTP_EFTU; Elongation factor Tu GTP binding domain (PF00009; HMM-score: 80.6)
    AIG1; AIG1 family (PF04548; HMM-score: 55.5)
    Dynamin_N; Dynamin family (PF00350; HMM-score: 54.3)
    RsgA_GTPase; RsgA GTPase (PF03193; HMM-score: 39.7)
    Roc; Ras of Complex, Roc, domain of DAPkinase (PF08477; HMM-score: 36.3)
    Ras; Ras family (PF00071; HMM-score: 32.4)
    ABC_tran; ABC transporter (PF00005; HMM-score: 25.6)
    Nribosyltransf (CL0498) Nuc_deoxyrib_tr; Nucleoside 2-deoxyribosyltransferase (PF05014; HMM-score: 24.2)
    P-loop_NTPase (CL0023) PduV-EutP; Ethanolamine utilisation - propanediol utilisation (PF10662; HMM-score: 24.1)
    cobW; CobW/HypB/UreG, nucleotide-binding domain (PF02492; HMM-score: 23.8)
    RNA_helicase; RNA helicase (PF00910; HMM-score: 21.6)
    SRPRB; Signal recognition particle receptor beta subunit (PF09439; HMM-score: 20.4)
    Arf; ADP-ribosylation factor family (PF00025; HMM-score: 19.4)
    Nribosyltransf (CL0498) Nuc_deoxyri_tr2; Nucleoside 2-deoxyribosyltransferase like (PF15891; HMM-score: 19.3)
    P-loop_NTPase (CL0023) AAA; ATPase family associated with various cellular activities (AAA) (PF00004; HMM-score: 18.7)
    AAA_29; P-loop containing region of AAA domain (PF13555; HMM-score: 17.5)
    AAA_22; AAA domain (PF13401; HMM-score: 16.7)
    AAA_24; AAA domain (PF13479; HMM-score: 16.6)
    AAA_16; AAA ATPase domain (PF13191; HMM-score: 16.3)
    AAA_18; AAA domain (PF13238; HMM-score: 15.7)
    NB-ARC; NB-ARC domain (PF00931; HMM-score: 15.1)
    TniB; Bacterial TniB protein (PF05621; HMM-score: 14.5)
    SRP54; SRP54-type protein, GTPase domain (PF00448; HMM-score: 14.3)
    no clan defined DUF1995; Domain of unknown function (DUF1995) (PF09353; HMM-score: 14)
    P-loop_NTPase (CL0023) NTPase_1; NTPase (PF03266; HMM-score: 13.6)
    AAA_14; AAA domain (PF13173; HMM-score: 12.6)
    AAA_15; AAA ATPase domain (PF13175; HMM-score: 12.5)
    TIM_barrel (CL0036) 4HFCP_synth; 4-HFC-P synthase (PF04476; HMM-score: 11.4)
    P-loop_NTPase (CL0023) AAA_23; AAA domain (PF13476; HMM-score: 10.1)

Structure, modifications & interactions[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:
    SA_RS02960elongation factor Tu  [1] (data from MRSA252)
    SA_RS05355pyruvate dehydrogenase E1 component subunit beta  [1] (data from MRSA252)
    SA_RS05360dihydrolipoyllysine-residue acetyltransferase component of pyruvate dehydrogenase complex  [1] (data from MRSA252)
    SA_RS05365dihydrolipoyl dehydrogenase  [1] (data from MRSA252)
    SA_RS0622530S ribosomal protein S2  [1] (data from MRSA252)
    SA_RS08560pyruvate kinase  [1] (data from MRSA252)
    SA_RS1168030S ribosomal protein S5  [1] (data from MRSA252)

Localization[edit | edit source]

  • PSORTb: Cytoplasmic Membrane
    • Cytoplasmic Score: 1.05
    • Cytoplasmic Membrane Score: 8.78
    • Cellwall Score: 0.08
    • Extracellular Score: 0.09
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.004999
    • TAT(Tat/SPI): 0.000234
    • LIPO(Sec/SPII): 0.000583
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

  • GI: 446087675 NCBI
  • RefSeq: WP_000165530 NCBI
  • UniProt:

Protein sequence[edit | edit source]

  • MTKPIVAIVGRPNVGKSTIFNRIVGERVSIVEDTPGVTRDRIYSSGEWLTHDFNIIDTGGIEIGDAPFQTQIRAQAEIAIDEADVIIFMVNVREGLTQSDEMVAQILYKSKKPVVLAVNKVDNMEMRTDVYDFYSLGFGEPYPISGSHGLGLGDLLDAVVSHFGEEEEDPYDEDTIRLSIIGRPNVGKSSLVNAILGEDRVIVSNVAGTTRDAIDTEYSYDGQDYVLIDTAGMRKKGKVYESTEKYSVLRALKAIERSNVVLVVIDAEQGIIEQDKRVAGYAHEQGKAVVIVVNKWDTVEKDSKTMKKFEDEVRKEFQFLDYAQIAFVSAKERTRLRTLFPYINEASENHKKRVQSSTLNEVVTDAISMNPTPTDKGRRLNVFYATQVAIEPPTFVVFVNDVELMHFSYKRYLENQIRAAFGFEGTPIHIIARKRN

Experimental data[edit | edit source]

  • experimentally validated: no data available

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

  1. 1.0 1.1 1.2 1.3 1.4 1.5 1.6 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J Proteome Res: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

Relevant publications[edit | edit source]