From AureoWiki
Jump to navigation Jump to search
PangenomeCOLN315NCTC8325NewmanUSA300_FPR3757JSNZ04-0298108BA0217611819-97685071193ECT-R 2ED133ED98HO 5096 0412JH1JH9JKD6008JKD6159LGA251M013MRSA252MSHR1132MSSA476MW2Mu3Mu50RF122ST398T0131TCH60TW20USA300_TCH1516VC40

NCBI: 02-MAR-2017

Summary[edit | edit source]

  • organism: Staphylococcus aureus N315
  • locus tag: SA_RS10455 [old locus tag: SA1821 ]
  • pan locus tag?: SAUPAN005219000
  • symbol: SA_RS10455
  • pan gene symbol?:
  • synonym:
  • product: hypothetical protein

Additional information (user-provided)[edit | edit source]

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SA_RS10455 [old locus tag: SA1821 ]
  • symbol: SA_RS10455
  • product: hypothetical protein
  • replicon: chromosome
  • strand: -
  • coordinates: 2062501..2062842
  • length: 342
  • essential: no DEG other strains

Accession numbers[edit | edit source]

  • Location: NC_002745 (2062501..2062842) NCBI
  • BioCyc: SA_RS10455 BioCyc
  • MicrobesOnline: see SA1821

Phenotype[edit | edit source]

Additional information (user-provided)[edit | edit source]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    ATGGATAAAAAGCAAATAAAAGACTTCGTTTGTGATTATCATAAGCGAACTATAAGTGAT
    GTGTTGATAGATGATGAAATAAATACCGATGAATTCTTTTCAATAGGTGATGAAAATTCT
    AATGAATGGATGGCAGACGATAACATTGATGATCATATTGTAAAGAATCACTTAGAAATG
    ATTGTTGACCAAGTAGCTAATGATAAAGAGTTTTATATTTTCGATTCTTTAATACAAGGA
    CGTAGTTTTAAAGATATTAGCAATGTCTTAGAGTGTTCAGAACAATCTGTAAGATTATGG
    TATGAAACCTTATTAGATAAAATTGTGGAGGTGATAGAATGA
    60
    120
    180
    240
    300
    342


Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SA_RS10455 [old locus tag: SA1821 ]
  • symbol: SA_RS10455
  • description: hypothetical protein
  • length: 113
  • theoretical pI: 3.9958
  • theoretical MW: 13367.8
  • GRAVY: -0.458407

Function[edit | edit source]

  • TIGRFAM:
    RNA polymerase sigma factor, sigma-70 family (TIGR02937; HMM-score: 19.6)
    and 1 more
    3'(2'),5'-bisphosphate nucleotidase (TIGR01330; EC 3.1.3.7; HMM-score: 15.5)
  • TheSEED: see SA1821
  • PFAM:
    HTH (CL0123) GerE; Bacterial regulatory proteins, luxR family (PF00196; HMM-score: 20.7)
    Phage_terminase; Phage terminase small subunit (PF10668; HMM-score: 17.1)
    and 4 more
    PDDEXK (CL0236) NgoMIV_restric; NgoMIV restriction enzyme (PF09015; HMM-score: 15.2)
    HTH (CL0123) HTH_Tnp_ISL3; Helix-turn-helix domain of transposase family ISL3 (PF13542; HMM-score: 13.9)
    Sigma70_r4_2; Sigma-70, region 4 (PF08281; HMM-score: 12.6)
    no clan defined DNA_gyraseB_C; DNA gyrase B subunit, carboxyl terminus (PF00986; HMM-score: 12.4)

Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • DeepLocPro: Cytoplasmic
    • Cytoplasmic Score: 0.8139
    • Cytoplasmic Membrane Score: 0.0143
    • Cell wall & surface Score: 0.0006
    • Extracellular Score: 0.1712
  • LocateP:
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.002718
    • TAT(Tat/SPI): 0.000165
    • LIPO(Sec/SPII): 0.000478
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

Additional information (user-provided)[edit | edit source]

Protein sequence[edit | edit source]

  • MDKKQIKDFVCDYHKRTISDVLIDDEINTDEFFSIGDENSNEWMADDNIDDHIVKNHLEMIVDQVANDKEFYIFDSLIQGRSFKDISNVLECSEQSVRLWYETLLDKIVEVIE

Experimental data[edit | edit source]

  • experimentally validated:
  • protein localization:
  • quantitative data / protein copy number per cell:
  • interaction partners:

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Additional information (user-provided)[edit | edit source]

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Additional information (user-provided)[edit | edit source]

Other information (user-provided)[edit | edit source]

You can add further information about the gene and protein here. [edit]

Literature[edit | edit source]

References[edit | edit source]


Relevant publications[edit | edit source]