Jump to navigation
Jump to search
NCBI: 02-MAR-2017
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus N315
- locus tag: SA_RS10515 [old locus tag: SA1832 ]
- pan locus tag?: SAUPAN005252000
- symbol: SA_RS10515
- pan gene symbol?: —
- synonym:
- product: excisionase
⊟Additional information (user-provided)[edit | edit source]
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: SA_RS10515 [old locus tag: SA1832 ]
- symbol: SA_RS10515
- product: excisionase
- replicon: chromosome
- strand: -
- coordinates: 2069699..2070016
- length: 318
- essential: no DEG
⊟Accession numbers[edit | edit source]
⊟Phenotype[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301ATGTTCAACATTAATATTGATGAAGATGAAGCACGTGAGTTACTTGAGCAGGCTATCAAT
GCACGTGTGGACGAATTAGCGAAAGAGAAATATTTTATGACTTACAAAGAGTTGTCTAAC
TATCTGAATTTAAGTAAGCCTACTATTGAAGAATTACTTATTAATAATGGCATGAAATAT
TATATGGTCGGATCTACGTATAGATTCAAAAAGTCTGATGTAGATGAATTCATGGAACAG
CTTACTGCTCATATGAATATCCAGAATAACGACTTTAAACAAGTCAATATCAAAAAGTTA
TTGGAGGCAAGGCAATGA60
120
180
240
300
318
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: SA_RS10515 [old locus tag: SA1832 ]
- symbol: SA_RS10515
- description: excisionase
- length: 105
- theoretical pI: 4.7476
- theoretical MW: 12523.2
- GRAVY: -0.658095
⊟Function[edit | edit source]
- TIGRFAM: Unknown function General DNA binding domain, excisionase family (TIGR01764; HMM-score: 70.2)and 2 moreDNA metabolism DNA replication, recombination, and repair ATP-dependent DNA helicase PcrA (TIGR01073; EC 3.6.4.12; HMM-score: 14.2)ParB/RepB/Spo0J family partition protein (TIGR00180; HMM-score: 12.3)
- TheSEED: see SA1832
- PFAM: HTH (CL0123) HTH_17; Helix-turn-helix domain (PF12728; HMM-score: 39.7)and 10 moreTn916-Xis; Excisionase from transposon Tn916 (PF09035; HMM-score: 16.2)TPR (CL0020) PI4KB-PIK1_PIK; PI4KB/PIK1, accessory (PIK) domain (PF21245; HMM-score: 14.7)HTH (CL0123) HTH_Mga; M protein trans-acting positive regulator (MGA) HTH domain (PF08280; HMM-score: 14.2)no clan defined DUF7180; Family of unknown function (DUF7180) (PF23805; HMM-score: 14.2)HTH (CL0123) NUMOD1; NUMOD1 domain (PF07453; HMM-score: 14.1)no clan defined DUF7623; Domain of unknown function (DUF7623) (PF24610; HMM-score: 13.6)HTH (CL0123) HTH_10; HTH DNA binding domain (PF04967; HMM-score: 13.3)HTH_26; Cro/C1-type HTH DNA-binding domain (PF13443; HMM-score: 12.8)HTH_5; Bacterial regulatory protein, arsR family (PF01022; HMM-score: 12.1)HeH (CL0306) PADR1_N; PADR1, N-terminal helical domain (PF21728; HMM-score: 11.1)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic
- Cytoplasmic Score: 7.5
- Cytoplasmic Membrane Score: 1.15
- Cellwall Score: 0.62
- Extracellular Score: 0.73
- Internal Helices: 0
- DeepLocPro: Cytoplasmic
- Cytoplasmic Score: 0.9731
- Cytoplasmic Membrane Score: 0.0009
- Cell wall & surface Score: 0.0004
- Extracellular Score: 0.0257
- LocateP:
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.005708
- TAT(Tat/SPI): 0.000272
- LIPO(Sec/SPII): 0.001546
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Protein sequence[edit | edit source]
- MFNINIDEDEARELLEQAINARVDELAKEKYFMTYKELSNYLNLSKPTIEELLINNGMKYYMVGSTYRFKKSDVDEFMEQLTAHMNIQNNDFKQVNIKKLLEARQ
⊟Experimental data[edit | edit source]
- experimentally validated:
- protein localization:
- quantitative data / protein copy number per cell:
- interaction partners:
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
⊟Regulation[edit | edit source]
- regulator:
⊟Additional information (user-provided)[edit | edit source]
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: no data available
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
- Aureolib: no data available
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Other information (user-provided)[edit | edit source]
You can add further information about the gene and protein here. [edit]
⊟Literature[edit | edit source]
⊟References[edit | edit source]