From AureoWiki
Jump to navigation Jump to search
PangenomeCOLN315NCTC8325NewmanUSA300_FPR3757JSNZ04-0298108BA0217611819-97685071193ECT-R 2ED133ED98HO 5096 0412JH1JH9JKD6008JKD6159LGA251M013MRSA252MSHR1132MSSA476MW2Mu3Mu50RF122ST398T0131TCH60TW20USA300_TCH1516VC40

NCBI: 26-AUG-2013

Summary[edit | edit source]

  • organism: Staphylococcus aureus N315
  • locus tag: SA1832 [new locus tag: SA_RS10515 ]
  • pan locus tag?: SAUPAN005252000
  • symbol: SA1832
  • pan gene symbol?:
  • synonym:
  • product: hypothetical protein

Additional information (user-provided)[edit | edit source]

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SA1832 [new locus tag: SA_RS10515 ]
  • symbol: SA1832
  • product: hypothetical protein
  • replicon: chromosome
  • strand: -
  • coordinates: 2069699..2070016
  • length: 318
  • essential: no DEG

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Additional information (user-provided)[edit | edit source]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    ATGTTCAACATTAATATTGATGAAGATGAAGCACGTGAGTTACTTGAGCAGGCTATCAAT
    GCACGTGTGGACGAATTAGCGAAAGAGAAATATTTTATGACTTACAAAGAGTTGTCTAAC
    TATCTGAATTTAAGTAAGCCTACTATTGAAGAATTACTTATTAATAATGGCATGAAATAT
    TATATGGTCGGATCTACGTATAGATTCAAAAAGTCTGATGTAGATGAATTCATGGAACAG
    CTTACTGCTCATATGAATATCCAGAATAACGACTTTAAACAAGTCAATATCAAAAAGTTA
    TTGGAGGCAAGGCAATGA
    60
    120
    180
    240
    300
    318


Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SA1832 [new locus tag: SA_RS10515 ]
  • symbol: SA1832
  • description: hypothetical protein
  • length: 105
  • theoretical pI: 4.7476
  • theoretical MW: 12523.2
  • GRAVY: -0.658095

Function[edit | edit source]

  • TIGRFAM:
    Unknown function General DNA binding domain, excisionase family (TIGR01764; HMM-score: 70.2)
    and 2 more
    Genetic information processing DNA metabolism DNA replication, recombination, and repair ATP-dependent DNA helicase PcrA (TIGR01073; EC 3.6.4.12; HMM-score: 14.2)
    ParB/RepB/Spo0J family partition protein (TIGR00180; HMM-score: 12.3)
  • TheSEED  :
    • Hypothetical SAV0787 homolog in superantigen-encoding pathogenicity islands SaPI
    Phages, Prophages, Transposable elements, Plasmids Pathogenicity islands Staphylococcal pathogenicity islands SaPI  Hypothetical SAV0787 homolog in superantigen-encoding pathogenicity islands SaPI
  • PFAM:
    HTH (CL0123) HTH_17; Helix-turn-helix domain (PF12728; HMM-score: 39.7)
    and 10 more
    Tn916-Xis; Excisionase from transposon Tn916 (PF09035; HMM-score: 16.2)
    TPR (CL0020) PI4KB-PIK1_PIK; PI4KB/PIK1, accessory (PIK) domain (PF21245; HMM-score: 14.7)
    HTH (CL0123) HTH_Mga; M protein trans-acting positive regulator (MGA) HTH domain (PF08280; HMM-score: 14.2)
    no clan defined DUF7180; Family of unknown function (DUF7180) (PF23805; HMM-score: 14.2)
    HTH (CL0123) NUMOD1; NUMOD1 domain (PF07453; HMM-score: 14.1)
    no clan defined DUF7623; Domain of unknown function (DUF7623) (PF24610; HMM-score: 13.6)
    HTH (CL0123) HTH_10; HTH DNA binding domain (PF04967; HMM-score: 13.3)
    HTH_26; Cro/C1-type HTH DNA-binding domain (PF13443; HMM-score: 12.8)
    HTH_5; Bacterial regulatory protein, arsR family (PF01022; HMM-score: 12.1)
    HeH (CL0306) PADR1_N; PADR1, N-terminal helical domain (PF21728; HMM-score: 11.1)

Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • DeepLocPro: Cytoplasmic
    • Cytoplasmic Score: 0.9731
    • Cytoplasmic Membrane Score: 0.0009
    • Cell wall & surface Score: 0.0004
    • Extracellular Score: 0.0257
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 1
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.005708
    • TAT(Tat/SPI): 0.000272
    • LIPO(Sec/SPII): 0.001546
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

Additional information (user-provided)[edit | edit source]

Protein sequence[edit | edit source]

  • MFNINIDEDEARELLEQAINARVDELAKEKYFMTYKELSNYLNLSKPTIEELLINNGMKYYMVGSTYRFKKSDVDEFMEQLTAHMNIQNNDFKQVNIKKLLEARQ

Experimental data[edit | edit source]

  • experimentally validated:
  • protein localization:
  • quantitative data / protein copy number per cell:
  • interaction partners:

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Additional information (user-provided)[edit | edit source]

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Additional information (user-provided)[edit | edit source]

Other information (user-provided)[edit | edit source]

You can add further information about the gene and protein here. [edit]

Literature[edit | edit source]

References[edit | edit source]


Relevant publications[edit | edit source]