From AureoWiki
Jump to navigation Jump to search

NCBI: 02-MAR-2017

Summary[edit | edit source]

  • organism: Staphylococcus aureus N315
  • locus tag: SA_RS13695 [old locus tag: SA2393 ]
  • pan locus tag?: SAUPAN006294000
  • symbol: SA_RS13695
  • pan gene symbol?: panE
  • synonym:
  • product: 2-dehydropantoate 2-reductase

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SA_RS13695 [old locus tag: SA2393 ]
  • symbol: SA_RS13695
  • product: 2-dehydropantoate 2-reductase
  • replicon: chromosome
  • strand: +
  • coordinates: 2680771..2681631
  • length: 861
  • essential: unknown

Accession numbers[edit | edit source]

  • Location: NC_002745 (2680771..2681631) NCBI
  • BioCyc: G1G21-2783 BioCyc
  • MicrobesOnline:

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    ATGTTATCAGTTGCGATTATCGGCCCAGGCGCTGTCGGTACAACTATTGCCTATGAATTA
    CAACAATCATTGCCTCATACAACGCTTATCGGGAGACACGCCAAAACAATAACATATTAT
    ACTGTACCACATGCACCTGCACAAGATATTGTTGTGAAAGGTTATGAAGATGTCACAAAC
    ACATTTGATGTTATTATTATTGCAGTCAAAACACATCAACTTGATGCCGTTATTCCTCAT
    TTAACTTATCTTGCACATGAGGACACGCTCATCATTTTAGCCCAAAATGGTTATGGTCAA
    CTCGAACATATTCCATTTAAAAATGTATGCCAAGCAGTTGTCTATATAAGTGGTCAAAAG
    AAAGGCGATGTTGTTACGCACTTCAGAGATTATCAATTACGTATACAAGATAATGCATTA
    ACTCGACAATTTAGAGATTTGGTCCAAGACAGTCAAATCGACATTGTATTAGAAGCAAAT
    ATTCAACAAGCTATTTGGTATAAATTGTTAGTTAACTTGGGCATTAATTCTATCACAGCA
    CTCGGGAGACAGACAGTTGCAATCATGCATAATCCTGAAATACGTATACTGTGTAGACAG
    TTATTACTAGATGGTTGTCGTGTTGCACAGGCAGAGGGGTTAAACTTTTCAGAACAAACT
    GTCGATACTATTATGACTATATATCAAGGTTATCCCGACGAAATGGGAACGAGCATGTAT
    TACGACATTGTGCATCAGCAACCTCTTGAAGTCGAAGCGATTCAAGGCTTTATTTATCGA
    CGTGCACGTGAACACAATCTTGACACCCCATATCTTGATACTATTTATAGCTTTTTACGC
    GCTTATCAACAAAATATGTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    861

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SA_RS13695 [old locus tag: SA2393 ]
  • symbol: SA_RS13695
  • description: 2-dehydropantoate 2-reductase
  • length: 286
  • theoretical pI: 5.92846
  • theoretical MW: 32433.9
  • GRAVY: -0.0328671

Function[edit | edit source]

  • reaction:
    EC 1.1.1.169?  ExPASy
    2-dehydropantoate 2-reductase (R)-pantoate + NADP+ = 2-dehydropantoate + NADPH
  • TIGRFAM:
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Pantothenate and coenzyme A 2-dehydropantoate 2-reductase (TIGR00745; EC 1.1.1.-; HMM-score: 170.7)
    and 1 more
    Metabolism Amino acid biosynthesis Glutamate family pyrroline-5-carboxylate reductase (TIGR00112; EC 1.5.1.2; HMM-score: 14.7)
  • TheSEED:
  • PFAM:
    6PGD_C (CL0106) ApbA_C; Ketopantoate reductase PanE/ApbA C terminal (PF08546; HMM-score: 102.1)
    and 9 more
    NADP_Rossmann (CL0063) ApbA; Ketopantoate reductase PanE/ApbA (PF02558; HMM-score: 61)
    F420_oxidored; NADP oxidoreductase coenzyme F420-dependent (PF03807; HMM-score: 28.4)
    NAD_Gly3P_dh_N; NAD-dependent glycerol-3-phosphate dehydrogenase N-terminus (PF01210; HMM-score: 23)
    DAO; FAD dependent oxidoreductase (PF01266; HMM-score: 16.8)
    Pyr_redox; Pyridine nucleotide-disulphide oxidoreductase (PF00070; HMM-score: 15.1)
    NAD_binding_2; NAD binding domain of 6-phosphogluconate dehydrogenase (PF03446; HMM-score: 14.2)
    Rossmann-like; Rossmann-like domain (PF10727; HMM-score: 13.7)
    IlvN; Acetohydroxy acid isomeroreductase, NADPH-binding domain (PF07991; HMM-score: 13.6)
    Pyr_redox_2; Pyridine nucleotide-disulphide oxidoreductase (PF07992; HMM-score: 11.6)

Structure, modifications & interactions[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic Membrane
    • Cytoplasmic Score: 1.78
    • Cytoplasmic Membrane Score: 8.16
    • Cellwall Score: 0.06
    • Extracellular Score: 0.01
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.090277
    • TAT(Tat/SPI): 0.003487
    • LIPO(Sec/SPII): 0.016301
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

  • GI: 446876316 NCBI
  • RefSeq: WP_000953572 NCBI
  • UniProt:

Protein sequence[edit | edit source]

  • MLSVAIIGPGAVGTTIAYELQQSLPHTTLIGRHAKTITYYTVPHAPAQDIVVKGYEDVTNTFDVIIIAVKTHQLDAVIPHLTYLAHEDTLIILAQNGYGQLEHIPFKNVCQAVVYISGQKKGDVVTHFRDYQLRIQDNALTRQFRDLVQDSQIDIVLEANIQQAIWYKLLVNLGINSITALGRQTVAIMHNPEIRILCRQLLLDGCRVAQAEGLNFSEQTVDTIMTIYQGYPDEMGTSMYYDIVHQQPLEVEAIQGFIYRRAREHNLDTPYLDTIYSFLRAYQQNM

Experimental data[edit | edit source]

  • experimentally validated: no data available

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

Relevant publications[edit | edit source]