From AureoWiki
Jump to navigation Jump to search

NCBI: 02-MAR-2017

Summary[edit | edit source]

  • organism: Staphylococcus aureus N315
  • locus tag: SA_RS13720 [old locus tag: SA2397 ]
  • pan locus tag?: SAUPAN006301000
  • symbol: SA_RS13720
  • pan gene symbol?:
  • synonym:
  • product: aspartate aminotransferase family protein

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SA_RS13720 [old locus tag: SA2397 ]
  • symbol: SA_RS13720
  • product: aspartate aminotransferase family protein
  • replicon: chromosome
  • strand: -
  • coordinates: 2685873..2687210
  • length: 1338
  • essential: unknown

Accession numbers[edit | edit source]

  • Location: NC_002745 (2685873..2687210) NCBI
  • BioCyc: G1G21-2788 BioCyc
  • MicrobesOnline:

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    ATGAGTAAAGCACATCAATTAATTCAAGAGGATGAACATTATTTTGCGAAATCAGGACGT
    ATTAAATATTATCCGTTAGTGATTGATCATGGATATGGAGCAACATTGGTTGATATTGAG
    GGGAAGACATATATCGATTTGTTATCGAGTGCAAGTTCTCAAAACGTAGGTCATGCACCT
    AGAGAAGTAACAGAAGCGATAAAGGCACAAGTTGATAAATTTATTCATTATACACCAGCA
    TATATGTATCATGAACCGTTGGTACGTTTAGCTAAGAAGCTTTGTGAGCTTGCACCTGGA
    GATTTTGAAAAAAGAGTGACCTTCGGATTAACCGGATCAGACGCAAATGATGGCATCATT
    AAATTTGCCAGAGCATATACAGGGCGTCCTTATATCATTAGTTTCACTAATGCATATCAT
    GGTTCAACTTTTGGCTCATTGTCTATGTCAGCTATTAGTTTAAATATGCGCAAACATTAT
    GGTCCGTTATTGAATGGTTTTTATCATATTCCGTTTCCAGATAAATATCGTGGTATGTAC
    GAGCAGCCACAAGCTAATTCAGTAGAAGAATATTTAGCACCCTTAAAAGAAATGTTTGCG
    AAATATGTACCTGCTGACGAAGTAGCATGTATTGTTATTGAAACGATACAAGGCGATGGT
    GGACTTTTAGAACCAGTTCCAGGGTATTTTGAAGCGTTAGAAAAGATTTGTCGTGAACAT
    GGTATTTTAATCGCTGTCGATGATATTCAACAAGGTTTTGGGCGAACAGGTACATGGAGT
    TCAGTCTCGCATTTTAATTTTACGCCTGATTTAATCACTTTCGGAAAATCCTTAGCAGGT
    GGTATGCCCATGTCAGCAATTGTTGGACGCAAAGAGATTATGAATTGTTTAGAAGCACCA
    GCACATTTATTTACAACAGGTGCTAATCCAGTTAGTTGTGAAGCTGCATTAGCCACAATT
    CAAATGATTGAAGATCAGTCGCTTCTTCAGGCTAGTGCGGAAAAAGGGGAATATGTTAGG
    AAACGAATGGATCAATGGGTATCTAAATACAATAGTGTAGGCGATGTTAGAGGTAAAGGT
    CTGAGCATTGGTATTGATATTGTTTCCGACAAAAAACTCAAAACACGTGATGCCAGTGCG
    GCACTTAAAATTTGTAATTACTGCTTTGAGCATGGCGTAGTTATTATAGCTGTAGCAGGA
    AATGTGTTGCGATTCCAACCGCCATTGGTGATAACATATGAGCAATTAGACACGGCGTTA
    AACACTATAGAAGATGCACTGACTGCTTTGGAAGCAGGTAACTTAGATCAATATGACATA
    TCTGGACAAGGTTGGTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1338

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SA_RS13720 [old locus tag: SA2397 ]
  • symbol: SA_RS13720
  • description: aspartate aminotransferase family protein
  • length: 445
  • theoretical pI: 5.90753
  • theoretical MW: 49081.7
  • GRAVY: -0.120899

Function[edit | edit source]

  • reaction:
    EC 2.6.1.19?  ExPASy
    4-aminobutyrate--2-oxoglutarate transaminase 4-aminobutanoate + 2-oxoglutarate = succinate semialdehyde + L-glutamate
  • TIGRFAM:
    Metabolism Central intermediary metabolism Other 4-aminobutyrate transaminase (TIGR00700; EC 2.6.1.19; HMM-score: 338.7)
    transaminase, acetylornithine/succinylornithine family (TIGR00707; HMM-score: 300.4)
    and 11 more
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Biotin adenosylmethionine-8-amino-7-oxononanoate transaminase (TIGR00508; EC 2.6.1.62; HMM-score: 254.2)
    ornithine--oxo-acid transaminase (TIGR01885; EC 2.6.1.13; HMM-score: 242.7)
    Metabolism Central intermediary metabolism Other 2,4-diaminobutyrate 4-transaminase (TIGR00709; EC 2.6.1.-; HMM-score: 225.9)
    Cellular processes Cellular processes Adaptations to atypical conditions diaminobutyrate--2-oxoglutarate aminotransferase (TIGR02407; EC 2.6.1.76; HMM-score: 216)
    Metabolism Energy metabolism Amino acids and amines succinylornithine transaminase family (TIGR03246; EC 2.6.1.81; HMM-score: 212.5)
    Metabolism Central intermediary metabolism Polyamine biosynthesis putrescine aminotransferase (TIGR03372; EC 2.6.1.82; HMM-score: 187.2)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Heme, porphyrin, and cobalamin glutamate-1-semialdehyde-2,1-aminomutase (TIGR00713; EC 5.4.3.8; HMM-score: 167.8)
    L-lysine 6-transaminase (TIGR03251; EC 2.6.1.36; HMM-score: 132)
    Metabolism Central intermediary metabolism Other 4-aminobutyrate aminotransferase (TIGR00699; EC 2.6.1.19; HMM-score: 100.6)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Biotin 8-amino-7-oxononanoate synthase (TIGR00858; EC 2.3.1.47; HMM-score: 30.2)
    putative pyridoxal phosphate-dependent acyltransferase (TIGR01825; EC 2.3.1.-; HMM-score: 20)
  • TheSEED:
  • PFAM:
    PLP_aminotran (CL0061) Aminotran_3; Aminotransferase class-III (PF00202; HMM-score: 351.3)
    and 1 more
    Aminotran_1_2; Aminotransferase class I and II (PF00155; HMM-score: 13.6)

Structure, modifications & interactions[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.67
    • Cytoplasmic Membrane Score: 0.01
    • Cellwall Score: 0.15
    • Extracellular Score: 0.17
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.007652
    • TAT(Tat/SPI): 0.00033
    • LIPO(Sec/SPII): 0.000366
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

  • GI: 445952217 NCBI
  • RefSeq: WP_000030072 NCBI
  • UniProt:

Protein sequence[edit | edit source]

  • MSKAHQLIQEDEHYFAKSGRIKYYPLVIDHGYGATLVDIEGKTYIDLLSSASSQNVGHAPREVTEAIKAQVDKFIHYTPAYMYHEPLVRLAKKLCELAPGDFEKRVTFGLTGSDANDGIIKFARAYTGRPYIISFTNAYHGSTFGSLSMSAISLNMRKHYGPLLNGFYHIPFPDKYRGMYEQPQANSVEEYLAPLKEMFAKYVPADEVACIVIETIQGDGGLLEPVPGYFEALEKICREHGILIAVDDIQQGFGRTGTWSSVSHFNFTPDLITFGKSLAGGMPMSAIVGRKEIMNCLEAPAHLFTTGANPVSCEAALATIQMIEDQSLLQASAEKGEYVRKRMDQWVSKYNSVGDVRGKGLSIGIDIVSDKKLKTRDASAALKICNYCFEHGVVIIAVAGNVLRFQPPLVITYEQLDTALNTIEDALTALEAGNLDQYDISGQGW

Experimental data[edit | edit source]

  • experimentally validated: no data available

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

Relevant publications[edit | edit source]