From AureoWiki
Jump to: navigation, search
NCBI: 06-JUL-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_0137 [new locus tag: NWMN_RS00755 ]
  • pan locus tag?: SAUPAN001036000
  • symbol: NWMN_0137
  • pan gene symbol?:
  • synonym:
  • product: transcriptional regulator

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: NWMN_0137 [new locus tag: NWMN_RS00755 ]
  • symbol: NWMN_0137
  • product: transcriptional regulator
  • replicon: chromosome
  • strand: +
  • coordinates: 172688..173566
  • length: 879
  • essential: unknown other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    ATGATGACAAATATTTTATATCGCATTGATAAGCAGTTGAGTGATTTTACGAAGACAGAA
    AAGATAATCGCTGATTACATTTTAAAGAATCCACATAAAATCATTGATATGACTGTGAAT
    GATTTGGCAGATGTTACGAATGTTAGTACAGCATCAATTGTTAGATTTAGTCGGAAAATG
    ACACATCAAGGTTTTCAAGAGCTAAAGATTGCGATATCTCGATACTTACCCGAAGATATT
    GCAACCAATCCACATTTAGAATTGATTGAAAATGAATCTGTAGAAACTTTGAAAAATAAA
    ATGATTGCTAGAGCAACGAATACGATGCGATTTGTAGCTACTAATATTATGGATGCGCAA
    ATTGATGCAATTTGTGATGTGTTGAAAAATGCCAGGACAATATTTTTATTTGGATTTGGC
    GCATCGAGTTTGACTATTGGTGATCTTTTTCAAAAGTTATCTCGTATTGGCTTAAATGTC
    AGGTTATTACATGAAACGCATTTACTTGTGTCAACATTTGCGACGCATGATGATAGAGAT
    TGCATGATTTTTGTGACGAATCAAGGTAGTCATAGTGAATTGCAGTCAATTGCACAGGTG
    GCCACACATTACAGTATTCCCATCATAACTATATCTAGTACAGCTAATAATCCAGTGGCT
    CAAATTGCAGACTATGCATTGATTTATGGCAGAACTGATGAAAATGAAATGCGTATGGCG
    GCTACAACGTCACTATTTGCACAGTTATTCACGGTAGATATATTGTACTATCGATTTGTA
    GCATTAAATTATCATGCGATTCTAGATTGTATAACCCAATCGAAAATGGCACTTGATAAT
    TACAGGAAGCATCTTGCGACGATAGATTTTAAACATTAG
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    879

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: NWMN_0137 [new locus tag: NWMN_RS00755 ]
  • symbol: NWMN_0137
  • description: transcriptional regulator
  • length: 292
  • theoretical pI: 6.91264
  • theoretical MW: 33117.9
  • GRAVY: 0.00924657

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    6-phospho 3-hexuloisomerase (TIGR03127; EC 5.3.-.-; HMM-score: 41.6)
    MetabolismEnergy metabolismSugarssugar isomerase, KpsF/GutQ family (TIGR00393; HMM-score: 29.6)
  • TheSEED:  
    Cell Wall and CapsuleCapsular and extracellular polysacchridesSialic Acid Metabolism Sialic acid utilization regulator, RpiR family 
  • PFAM:
    HTH (CL0123) HTH_6; Helix-turn-helix domain, rpiR family (PF01418; HMM-score: 80)
    SIS (CL0067) SIS; SIS domain (PF01380; HMM-score: 53.3)
    SIS_2; SIS domain (PF13580; HMM-score: 16.8)
    HTH (CL0123) MarR; MarR family (PF01047; HMM-score: 15.4)
    MarR_2; MarR family (PF12802; HMM-score: 15.3)
    no clan definedDUF2325; Uncharacterized protein conserved in bacteria (DUF2325) (PF10087; HMM-score: 13.9)
    HTH (CL0123) HTH_Crp_2; Crp-like helix-turn-helix domain (PF13545; HMM-score: 12.4)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.12
    • Ymax_pos: 11
    • Cmax: 0.114
    • Cmax_pos: 52
    • Smax: 0.219
    • Smax_pos: 7
    • Smean: 0.148
    • D: 0.131
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MMTNILYRIDKQLSDFTKTEKIIADYILKNPHKIIDMTVNDLADVTNVSTASIVRFSRKMTHQGFQELKIAISRYLPEDIATNPHLELIENESVETLKNKMIARATNTMRFVATNIMDAQIDAICDVLKNARTIFLFGFGASSLTIGDLFQKLSRIGLNVRLLHETHLLVSTFATHDDRDCMIFVTNQGSHSELQSIAQVATHYSIPIITISSTANNPVAQIADYALIYGRTDENEMRMAATTSLFAQLFTVDILYYRFVALNYHAILDCITQSKMALDNYRKHLATIDFKH

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulators: NWMN_0137, CcpA
    NWMN_0137 (TF) important in N-acetylmuramate utilization
    CcpA (TF) important in Carbon catabolism

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]