From AureoWiki
Jump to: navigation, search
NCBI: 06-JUL-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_0199 [new locus tag: NWMN_RS01110 ]
  • pan locus tag?: SAUPAN001145000
  • symbol: NWMN_0199
  • pan gene symbol?:
  • synonym:
  • product: PTS system, IIA component

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: NWMN_0199 [new locus tag: NWMN_RS01110 ]
  • symbol: NWMN_0199
  • product: PTS system, IIA component
  • replicon: chromosome
  • strand: +
  • coordinates: 256196..256987
  • length: 792
  • essential: unknown other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    ATGAGCAATAAATATAAAGAACAAGCCCAAGACATTCTTACAGCTGTAGGTGGTGTCGAA
    AACATTGTTGATGCAACGTATGATACGAAGTGCATTACAATTCATATGCAACATACAATT
    CCTTCTACAGCAAATGAAGTGAAACAAATAGTTGATGTGACATCTGTAGCAGAAAATGAT
    ACGCAGTTAGTCATAAAATTAAATGGAAATGTCGATGAAGTGTATCAGCAATTACAGCGA
    TTAATTAAGAATGCTAATGTCGAAGAGAGTGAGAATACTGACAATATTAATAGTCAAGAT
    ACAAGTTATACACCTCAAGTAAAAGTAACAACACCAATTTTAGTGAAAGCACCAATCGCT
    GGTCGTCGTATTTTACTTAAAGAAGTAAGAGATTCAATTTTTAGAGAGAAAATGGTAGGT
    GAAGGCTTAGCAATCAAAGCTCATGAAGAATCCAAAGTAATCGCACCGTTCAATGGTTTA
    ATATCTATGATTGTACCAACTAAGCATGCAGTTGGTATTCAATCAGAAGACGGTGTGGAC
    ATAGTCATTCATATTGGCGTGAATACAGTTGACTTGGAAGGTAAAGGGTTCAAGTGCTTT
    GTAAAGCAAAATGATCATGTTGAAGCAGGGCAAACGTTGTTGCAATTCGACCAGCAATAT
    ATACAACAACAAGGCTACAATGCTGACGTTATTGTCGTTATTAGCAACTCTGCCGATTTA
    GGAAAAGTAGAACTGACAATGAATGAAATCATTACGACTGAAGATGTTATTTTTAAAATA
    TTTAAAAACTAG
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    792

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: NWMN_0199 [new locus tag: NWMN_RS01110 ]
  • symbol: NWMN_0199
  • description: PTS system, IIA component
  • length: 263
  • theoretical pI: 4.71001
  • theoretical MW: 29136.9
  • GRAVY: -0.180608

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    PTS system, beta-glucoside-specific IIABC component (TIGR01995; EC 2.7.1.69; HMM-score: 170.1)
    MetabolismTransport and binding proteinsCarbohydrates, organic alcohols, and acidsPTS system, glucose subfamily, IIA component (TIGR00830; HMM-score: 129.4)
    Signal transductionSignal transductionPTSPTS system, glucose subfamily, IIA component (TIGR00830; HMM-score: 129.4)
    PTS system, sucrose-specific IIBC component (TIGR01996; EC 2.7.1.69; HMM-score: 28.2)
    PTS system, trehalose-specific IIBC component (TIGR01992; EC 2.7.1.69; HMM-score: 28.1)
  • TheSEED:  
    Chitin and N-acetylglucosamine utilization PTS system, N-acetylglucosamine-specific IIA component / PTS system, N-acetylglucosamine-specific IIB component (EC 2.7.1.69) / PTS system, N-acetylglucosamine-specific IIC component 
    Sialic Acid Metabolism PTS system, N-acetylglucosamine-specific IIA component / PTS system, N-acetylglucosamine-specific IIB component (EC 2.7.1.69) / PTS system, N-acetylglucosamine-specific IIC component 
  • PFAM:
    Hybrid (CL0105) PTS_EIIA_1; phosphoenolpyruvate-dependent sugar phosphotransferase system, EIIA 1 (PF00358; HMM-score: 150.8)
    Biotin_lipoyl_2; Biotin-lipoyl like (PF13533; HMM-score: 23.4)
    no clan definedPTS_EIIB; phosphotransferase system, EIIB (PF00367; HMM-score: 15.6)
    Hybrid (CL0105) Peptidase_M23; Peptidase family M23 (PF01551; HMM-score: 15)
    no clan definedTPD; Protein of unknown function TPD sequence-motif (PF14811; HMM-score: 12.9)
    Hybrid (CL0105) RnfC_N; RnfC Barrel sandwich hybrid domain (PF13375; HMM-score: 11.3)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic Membrane
    • Cytoplasmic Score: 0.17
    • Cytoplasmic Membrane Score: 9.51
    • Cellwall Score: 0.16
    • Extracellular Score: 0.15
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.126
    • Ymax_pos: 50
    • Cmax: 0.145
    • Cmax_pos: 28
    • Smax: 0.192
    • Smax_pos: 43
    • Smean: 0.101
    • D: 0.117
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MSNKYKEQAQDILTAVGGVENIVDATYDTKCITIHMQHTIPSTANEVKQIVDVTSVAENDTQLVIKLNGNVDEVYQQLQRLIKNANVEESENTDNINSQDTSYTPQVKVTTPILVKAPIAGRRILLKEVRDSIFREKMVGEGLAIKAHEESKVIAPFNGLISMIVPTKHAVGIQSEDGVDIVIHIGVNTVDLEGKGFKCFVKQNDHVEAGQTLLQFDQQYIQQQGYNADVIVVISNSADLGKVELTMNEIITTEDVIFKIFKN

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator: NWMN_0198 (BglR*)
    BglR* (TF) important in Beta-glucosides utilization  RegPrecise

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]