From AureoWiki
Jump to: navigation, search
NCBI: 06-JUL-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_0604 [new locus tag: NWMN_RS03440 ]
  • pan locus tag?: SAUPAN002510000
  • symbol: feoA
  • pan gene symbol?: mntR
  • synonym:
  • product: iron dependent repressor

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: NWMN_0604 [new locus tag: NWMN_RS03440 ]
  • symbol: feoA
  • product: iron dependent repressor
  • replicon: chromosome
  • strand: +
  • coordinates: 684492..685136
  • length: 645
  • essential: unknown other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    ATGTTAACTGAAGAAAAAGAGGACTATTTAAAGGCAATCCTTACGAATAATGGCGATAAA
    AACTTTGTGACAAATAAAATCTTATCTCAATTTTTAAATATTAAGCCTCCATCTGTAAGT
    GAAATGGTAGGACGTCTTGAAAAAGCAGGCTATGTTGAAACAAAACCATACAAAGGTGTT
    AGATTAACAGAGGATGGTTTAACGCATACGCTTGATATCATTAAGAGACATCGACTATTA
    GAATTATTTTTAATAGAAATATTGAAATATAATTGGGAAGAAGTACATCAAGAAGCAGAA
    ATTTTAGAACATCGAATTTCAGATTTATTTGTTGAAAGGCTGGATAGCCTGTTAAATTTC
    CCAGAAACTTGCCCGCACGGCGGTGTGATTCCTAGAAATAATGAATATAAAGAGAAATAT
    ATAACAACGATTTTGAATTATGAACCTGGTGATATCGTTACAATCAAACGTGTGAGAGAT
    AAGACCGATTTGCTAATATATTTGTCTAGTAAAGATATTTCTATTGGTAATGAAGTGGAA
    ATTGTATCGAAAGATGAAATGAATAAAGTAATTATCATTAAACGTAATGATAATGTAATT
    ATTGTCAGTTACGAAAATGCAATGAACATGTTTGCTGAAAAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    645

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: NWMN_0604 [new locus tag: NWMN_RS03440 ]
  • symbol: FeoA
  • description: iron dependent repressor
  • length: 214
  • theoretical pI: 5.22243
  • theoretical MW: 24884.5
  • GRAVY: -0.356075

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
  • TheSEED:  
    Mn-dependent transcriptional regulator MntR 
  • PFAM:
    HTH (CL0123) Fe_dep_repr_C; Iron dependent repressor, metal binding and dimerisation domain (PF02742; HMM-score: 94.7)
    Fe_dep_repress; Iron dependent repressor, N-terminal DNA binding domain (PF01325; HMM-score: 87.1)
    TRB (CL0206) FeoA; FeoA domain (PF04023; HMM-score: 30.9)
    HTH (CL0123) HTH_24; Winged helix-turn-helix DNA-binding (PF13412; HMM-score: 25.1)
    MarR_2; MarR family (PF12802; HMM-score: 23.4)
    MarR; MarR family (PF01047; HMM-score: 21.2)
    HTH_Crp_2; Crp-like helix-turn-helix domain (PF13545; HMM-score: 19.3)
    Rrf2; Transcriptional regulator (PF02082; HMM-score: 19.2)
    HTH_27; Winged helix DNA-binding domain (PF13463; HMM-score: 18.5)
    Rio2_N; Rio2, N-terminal (PF09202; HMM-score: 15.3)
    TrmB; Sugar-specific transcriptional regulator TrmB (PF01978; HMM-score: 13.2)
    AbrB (CL0132) MazE_antitoxin; Antidote-toxin recognition MazE, bacterial antitoxin (PF04014; HMM-score: 10)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: -1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.125
    • Ymax_pos: 46
    • Cmax: 0.114
    • Cmax_pos: 40
    • Smax: 0.201
    • Smax_pos: 39
    • Smean: 0.103
    • D: 0.116
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MLTEEKEDYLKAILTNNGDKNFVTNKILSQFLNIKPPSVSEMVGRLEKAGYVETKPYKGVRLTEDGLTHTLDIIKRHRLLELFLIEILKYNWEEVHQEAEILEHRISDLFVERLDSLLNFPETCPHGGVIPRNNEYKEKYITTILNYEPGDIVTIKRVRDKTDLLIYLSSKDISIGNEVEIVSKDEMNKVIIIKRNDNVIIVSYENAMNMFAEK

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • feoA no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]