From AureoWiki
Jump to: navigation, search
NCBI: 06-JUL-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_0611 [new locus tag: NWMN_RS03475 ]
  • pan locus tag?: SAUPAN002518000
  • symbol: tagD
  • pan gene symbol?: tagD
  • synonym:
  • product: glycerol-3-phosphate cytidylyltransferase

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: NWMN_0611 [new locus tag: NWMN_RS03475 ]
  • symbol: tagD
  • product: glycerol-3-phosphate cytidylyltransferase
  • replicon: chromosome
  • strand: +
  • coordinates: 691303..691701
  • length: 399
  • essential: unknown other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    ATGAAACGTGTAATAACATATGGCACATATGACTTACTTCACTATGGTCATATCGAATTG
    CTTCGTCGTGCAAGAGAGATGGGCGATTATTTAATAGTAGCATTATCAACAGATGAATTT
    AATCAAATTAAACATAAAAAATCTTATTATGATTATGAACAACGAAAAATGATGCTTGAA
    TCAATACGCTATGTCGATTTAGTCATTCCAGAAAAGGGCTGGGGACAAAAAGAAGACGAT
    GTCGAAAAATTTGATGTAGATGTTTTTGTTATGGGACATGACTGGGAAGGTGAATTCGAC
    TTCTTAAAGGATAAATGTGAAGTCATTTATTTAAAACGTACAGAAGGCATTTCGACGACT
    AAAATCAAACAAGAATTATATGGTAAAGATGCTAAATAA
    60
    120
    180
    240
    300
    360
    399

Protein[edit source | edit]

Protein Data Bank: 2B7L

General[edit source | edit]

  • locus tag: NWMN_0611 [new locus tag: NWMN_RS03475 ]
  • symbol: TagD
  • description: glycerol-3-phosphate cytidylyltransferase
  • length: 132
  • theoretical pI: 5.69067
  • theoretical MW: 15817
  • GRAVY: -0.660606

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    Cell structureCell envelopeBiosynthesis and degradation of murein sacculus and peptidoglycanglycerol-3-phosphate cytidylyltransferase (TIGR01518; EC 2.7.7.39; HMM-score: 201)
    cytidyltransferase-like domain (TIGR00125; HMM-score: 77.8)
    Cell structureCell envelopeBiosynthesis and degradation of surface polysaccharides and lipopolysaccharidesbifunctional protein RfaE, domain II (TIGR02199; EC 2.7.7.-; HMM-score: 61.5)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersPantothenate and coenzyme Apantetheine-phosphate adenylyltransferase (TIGR01510; EC 2.7.7.3; HMM-score: 29.9)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersPyridine nucleotidesnicotinate (nicotinamide) nucleotide adenylyltransferase (TIGR00482; EC 2.7.7.18; HMM-score: 15.2)
    nicotinamide-nucleotide adenylyltransferase (TIGR01526; EC 2.7.7.1; HMM-score: 13.8)
  • TheSEED:  
    Cell Wall and CapsuleGram-Positive cell wall componentsTeichoic and lipoteichoic acids biosynthesis Glycerol-3-phosphate cytidylyltransferase (EC 2.7.7.39) 
  • PFAM:
    HUP (CL0039) CTP_transf_like; Cytidylyltransferase-like (PF01467; HMM-score: 83.6)
    FAD_syn; FAD synthetase (PF06574; HMM-score: 18.2)
    HIGH_NTase1_ass; Cytidyltransferase-related C-terminal region (PF16581; HMM-score: 14.9)
    Pantoate_ligase; Pantoate-beta-alanine ligase (PF02569; HMM-score: 13.8)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:
    NWMN_0961(pdhC)branched-chain alpha-keto acid dehydrogenase subunit E2  [1] (data from MRSA252)
    NWMN_0959(phdA)pyruvate dehydrogenase E1 component, alpha subunit  [1] (data from MRSA252)
    NWMN_0960(phdB)pyruvate dehydrogenase E1 component, beta subunit  [1] (data from MRSA252)
    NWMN_0877(ppnK)inorganic polyphosphate/ATP-NAD kinase  [1] (data from MRSA252)
    NWMN_0510(tufA)elongation factor Tu  [1] (data from MRSA252)

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.105
    • Ymax_pos: 47
    • Cmax: 0.116
    • Cmax_pos: 49
    • Smax: 0.15
    • Smax_pos: 45
    • Smean: 0.07
    • D: 0.091
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MKRVITYGTYDLLHYGHIELLRRAREMGDYLIVALSTDEFNQIKHKKSYYDYEQRKMMLESIRYVDLVIPEKGWGQKEDDVEKFDVDVFVMGHDWEGEFDFLKDKCEVIYLKRTEGISTTKIKQELYGKDAK

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. 1.0 1.1 1.2 1.3 1.4 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J. Proteome Res.: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

Relevant publications[edit source | edit]