From AureoWiki
Jump to: navigation, search
NCBI: 06-JUL-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_0698 [new locus tag: NWMN_RS03950 ]
  • pan locus tag?: SAUPAN002627000
  • symbol: NWMN_0698
  • pan gene symbol?:
  • synonym:
  • product: hypothetical protein

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: NWMN_0698 [new locus tag: NWMN_RS03950 ]
  • symbol: NWMN_0698
  • product: hypothetical protein
  • replicon: chromosome
  • strand: -
  • coordinates: 782596..783462
  • length: 867
  • essential: unknown other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    TTGAATCCTAAAGTAAAAGGTATCATTGCCATTTTAATTTCGGCTATTGGTTTCAGTTTT
    ATGTCAGTGTTTTTCAGACTTGCAGGTGACCTTCCTGTTTTTCAAAAATCATTAGCACGA
    AACTTAGTAGCAATGTTTATTCCATTATTTTTTATATATAAATACCATCAGCCAATGTTT
    GGCAGACTTTCAAGTCAACCCTTATTAATAACACGATCAACACTTGGACTTATTGGTGTA
    TTGTTAAATATTTATGCCATTGATCATATGGTACTTAGTGATGCCGATTCATTAATGAAA
    CTCAATCCTTTCTGGACGATTTTATTAAGCATTGTTTTCTTACATGAAAAGGTAAGGAAG
    TATCAAATTACAGCAATGATAATTGCTATTTTAGGTATGCTTTTAATAGTGAAACCTGAA
    TTTTCATCATCTATGATTCCATCATTAGCTGGCTTATTCTCAGGTATTTTTGCAGCATCA
    GCATATACATGTGTTCGAGCACTTAGTACAAGAGAAGCACCATATACTATAGTATTTTAC
    TTCTCCTTATTTTCTGTCATCGTTTTAATACCTTTCACTGCATATACTTATGAACCAATG
    AGTCAGATGCAAATACTTTATCTATTAGGGGCTGGCTTAGCTGCCGCTGTGGGTCAAATT
    GGTGTTACTTTAGCATATAGTTTTGCAGCAGCAAAAGATATTTCTATTTTTACGTATGCA
    TCTATAATTTTCACAGCAATACTTGGATTTATTCTATTCGGAGAATCTCCAGATTTCTAT
    GCAACATTAGGTTACGTCGTTATTATCGGTGCAAGTTATTACATGTTTGAAAAAGCACGC
    CGAGACGCCAAAATAATAAAAAAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    867

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: NWMN_0698 [new locus tag: NWMN_RS03950 ]
  • symbol: NWMN_0698
  • description: hypothetical protein
  • length: 288
  • theoretical pI: 9.85057
  • theoretical MW: 31954.1
  • GRAVY: 0.866667

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    MetabolismTransport and binding proteinsAmino acids, peptides and aminescarboxylate/amino acid/amine transporter (TIGR00950; HMM-score: 40.1)
    MetabolismTransport and binding proteinsUnknown substrateprotein RarD (TIGR00688; HMM-score: 19.7)
    phosphonate utilization associated putative membrane protein (TIGR03340; HMM-score: 14.2)
  • TheSEED:  
    Integral membrane domain protein 
  • PFAM:
    DMT (CL0184) EamA; EamA-like transporter family (PF00892; HMM-score: 82.8)
    TPT; Triose-phosphate Transporter family (PF03151; HMM-score: 21.9)
    Mg_trans_NIPA; Magnesium transporter NIPA (PF05653; HMM-score: 20.1)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic Membrane
    • Cytoplasmic Score: 0
    • Cytoplasmic Membrane Score: 10
    • Cellwall Score: 0
    • Extracellular Score: 0
    • Internal Helices: 8
  • LocateP: Multi-transmembrane
    • Prediction by SwissProt Classification: Membrane
    • Pathway Prediction: Sec-(SPI)
    • Intracellular Possibility: 0.17
    • Signal Peptide Possibility: -0.5
    • N-terminally Anchored Score: -1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.187
    • Ymax_pos: 22
    • Cmax: 0.136
    • Cmax_pos: 29
    • Smax: 0.354
    • Smax_pos: 6
    • Smean: 0.296
    • D: 0.23
  • predicted transmembrane helices (TMHMM): 10

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MNPKVKGIIAILISAIGFSFMSVFFRLAGDLPVFQKSLARNLVAMFIPLFFIYKYHQPMFGRLSSQPLLITRSTLGLIGVLLNIYAIDHMVLSDADSLMKLNPFWTILLSIVFLHEKVRKYQITAMIIAILGMLLIVKPEFSSSMIPSLAGLFSGIFAASAYTCVRALSTREAPYTIVFYFSLFSVIVLIPFTAYTYEPMSQMQILYLLGAGLAAAVGQIGVTLAYSFAAAKDISIFTYASIIFTAILGFILFGESPDFYATLGYVVIIGASYYMFEKARRDAKIIKK

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator: LexA
    LexA (TF) important in SOS responseRegPrecise

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]