From AureoWiki
Jump to: navigation, search
NCBI: 06-JUL-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_0933 [new locus tag: NWMN_RS05225 ]
  • pan locus tag?: SAUPAN003277000
  • symbol: purE
  • pan gene symbol?: purE
  • synonym:
  • product: phosphoribosylaminoimidazole carboxylase catalytic subunit

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: NWMN_0933 [new locus tag: NWMN_RS05225 ]
  • symbol: purE
  • product: phosphoribosylaminoimidazole carboxylase catalytic subunit
  • replicon: chromosome
  • strand: +
  • coordinates: 1036095..1036577
  • length: 483
  • essential: unknown other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    GTGAAAGTAGCAGTCATTATGGGCAGTTCTTCCGATTGGAAAATTATGCAAGAGAGTTGT
    AACATGTTGGATTATTTTGAAATTCCGTACGAAAAACAAGTAGTATCCGCACATCGTACG
    CCAAAAATGATGGTTCAATTTGCTTCTGAAGCGAGAGAAAGAGGTATAAACATTATCATT
    GCAGGCGCTGGCGGTGCGGCACATTTACCAGGTATGGTTGCATCATTAACGACGCTACCA
    GTTATTGGAGTGCCGATTGAAACAAAAAGTTTAAAGGGTATAGATTCTTTATTATCAATT
    GTTCAAATGCCAGGAGGTATTCCGGTTGCAACGACTGCAATTGGTGCAGCAGGTGCTAAA
    AACGCAGGTATACTTGCAGCAAGAATGTTAAGTATTCAAAATCCTTCTTTAGTTGAAAAA
    CTAAATCAGTATGAATCTTCGTTAATTCAAAAAGTGGAGGACATGCAAAATGAACTTCAA
    TAA
    60
    120
    180
    240
    300
    360
    420
    480
    483

Protein[edit source | edit]

Protein Data Bank: 3ORS

General[edit source | edit]

  • locus tag: NWMN_0933 [new locus tag: NWMN_RS05225 ]
  • symbol: PurE
  • description: phosphoribosylaminoimidazole carboxylase catalytic subunit
  • length: 160
  • theoretical pI: 6.52439
  • theoretical MW: 17068.9
  • GRAVY: 0.189375

Function[edit source | edit]

  • reaction:
    EC 5.4.99.18?  ExPASy
    5-(carboxyamino)imidazole ribonucleotide mutase5-carboxyamino-1-(5-phospho-D-ribosyl)imidazole = 5-amino-1-(5-phospho-D-ribosyl)imidazole-4-carboxylate
  • TIGRFAM:
    MetabolismPurines, pyrimidines, nucleosides, and nucleotidesPurine ribonucleotide biosynthesisphosphoribosylaminoimidazole carboxylase, catalytic subunit (TIGR01162; EC 4.1.1.21; HMM-score: 217.1)
  • TheSEED:  
    De Novo Purine Biosynthesis N5-carboxyaminoimidazole ribonucleotide mutase (EC 5.4.99.18) 
  • PFAM:
    no clan definedAIRC; AIR carboxylase (PF00731; HMM-score: 214.3)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic Membrane
    • Cytoplasmic Score: 0.32
    • Cytoplasmic Membrane Score: 9.55
    • Cellwall Score: 0.12
    • Extracellular Score: 0.01
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.115
    • Ymax_pos: 11
    • Cmax: 0.142
    • Cmax_pos: 38
    • Smax: 0.158
    • Smax_pos: 1
    • Smean: 0.128
    • D: 0.12
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MKVAVIMGSSSDWKIMQESCNMLDYFEIPYEKQVVSAHRTPKMMVQFASEARERGINIIIAGAGGAAHLPGMVASLTTLPVIGVPIETKSLKGIDSLLSIVQMPGGIPVATTAIGAAGAKNAGILAARMLSIQNPSLVEKLNQYESSLIQKVEDMQNELQ

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]